EMAIL THIS PAGE TO A FRIEND

CALB2

calbindin 2

120 Gene Product Result for
Synonyms: CAB29 CAL2 CR
UniProtKB ID: P22676, A8K4Y1, Q53HD2, Q96BK4
Gene ID:
Human(794) Summary: This gene encodes an intracellular calcium-binding protein belonging to the troponin C superfamily. Members of this protein family have six EF-hand domains which bind calcium. This protein plays a role in diverse cellular functions, including message targeting and intracellular calcium buffering. It also functions as a modulator of neuronal excitability, and is a diagnostic marker for some human diseases, including Hirschsprung disease and some cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010]
Mouse(12308) calbindin 2
Rat(117059) calbindin 2
sheep(101105843) calbindin 2
chicken(396255) calbindin 2, 29kDa (calretinin)
cow(513947) calbindin 2
dog(610586) calbindin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001740 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001740 Rosetta Predictions human pricing
NM_007087 Rosetta Predictions human pricing
NM_007088 Rosetta Predictions human pricing
NM_053988 Rosetta Predictions rat pricing
NM_007586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001740 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332456 predicted 239
2 SASI_Hs01_00142651 predicted 326
3 SASI_Hs01_00142652 predicted 1139
4 SASI_Hs01_00142653 predicted 1138
5 SASI_Hs01_00142654 predicted 1171
6 SASI_Hs01_00142655 predicted 1160
7 SASI_Hs01_00142657 predicted 938
8 SASI_Hs01_00142658 predicted 1129
9 SASI_Hs01_00142659 predicted 1134
10 SASI_Hs01_00142660 predicted 1180
11 SASI_Hs01_00142656 predicted 226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204226 predicted 240
2 SASI_Hs01_00204218 predicted 332
3 SASI_Hs01_00204219 predicted 1098
4 SASI_Hs01_00204220 predicted 1102
5 SASI_Hs01_00204222 predicted 896
6 SASI_Hs01_00204223 predicted 1088
7 SASI_Hs01_00204224 predicted 1093
8 SASI_Hs01_00204221 predicted 214
9 SASI_Hs01_00204227 predicted 109
10 SASI_Hs02_00342927 predicted 540
11 SASI_Hs01_00204225 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342928 predicted 238
2 SASI_Hs01_00053945 predicted 326
3 SASI_Hs01_00053946 predicted 1045
4 SASI_Hs01_00053947 predicted 1043
5 SASI_Hs01_00053948 predicted 1076
6 SASI_Hs01_00053949 predicted 1071
7 SASI_Hs01_00053951 predicted 842
8 SASI_Hs01_00053952 predicted 1028
9 SASI_Hs01_00053953 predicted 1041
10 SASI_Hs01_00053954 predicted 1081
11 SASI_Hs01_00053950 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053988 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104919 predicted 431
2 SASI_Rn01_00104920 predicted 822
3 SASI_Rn01_00104921 predicted 275
4 SASI_Rn01_00104923 predicted 538
5 SASI_Rn01_00104924 predicted 534
6 SASI_Rn01_00104925 predicted 212
7 SASI_Rn01_00104926 predicted 436
8 SASI_Rn01_00104927 predicted 522
9 SASI_Rn02_00266984 predicted 572
10 SASI_Rn02_00266985 predicted 742
11 SASI_Rn01_00104918 predicted 589
12 SASI_Rn01_00104922 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113958 predicted 554
2 SASI_Mm01_00113959 predicted 454
3 SASI_Mm01_00113960 predicted 594
4 SASI_Mm01_00113961 predicted 634
5 SASI_Mm01_00113962 predicted 553
6 SASI_Mm01_00113963 predicted 534
7 SASI_Mm01_00113964 predicted 658
8 SASI_Mm01_00113965 predicted 606
9 SASI_Mm01_00113966 predicted 534
10 SASI_Mm01_00113967 predicted 613
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001740
CALB2 MISSION shRNA Bacterial Glycerol Stock
calbindin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001740.3-1172s21c1
Sequence:CCGGAGCTCCCTCGCTGTATGATTTCTCGAGAAATCATACAGCGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-157s21c1
Sequence:CCGGCGCAGACGGAAATGGGTATATCTCGAGATATACCCATTTCCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-668s21c1
Sequence:CCGGTTTAACGCGATCTTCACATTTCTCGAGAAATGTGAAGATCGCGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-133s1c1
Sequence:CCGGCCTGGAAATATGGAAGCACTTCTCGAGAAGTGCTTCCATATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-694s1c1
Sequence:CCGGCAAGGATAGAAGCGGCTACATCTCGAGATGTAGCCGCTTCTATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-274s1c1
Sequence:CCGGGAAGGAGTTCATGCAGAAGTACTCGAGTACTTCTGCATGAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-347s1c1
Sequence:CCGGCCAACCGAAGAGAACTTCCTTCTCGAGAAGGAAGTTCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-538s1c1
Sequence:CCGGCCAAACCATACTACGGATGTTCTCGAGAACATCCGTAGTATGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001740
CALB2 MISSION shRNA shRNA Plasmid DNA
calbindin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001740.3-1172s21c1
Sequence:CCGGAGCTCCCTCGCTGTATGATTTCTCGAGAAATCATACAGCGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-157s21c1
Sequence:CCGGCGCAGACGGAAATGGGTATATCTCGAGATATACCCATTTCCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-668s21c1
Sequence:CCGGTTTAACGCGATCTTCACATTTCTCGAGAAATGTGAAGATCGCGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-133s1c1
Sequence:CCGGCCTGGAAATATGGAAGCACTTCTCGAGAAGTGCTTCCATATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-694s1c1
Sequence:CCGGCAAGGATAGAAGCGGCTACATCTCGAGATGTAGCCGCTTCTATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-274s1c1
Sequence:CCGGGAAGGAGTTCATGCAGAAGTACTCGAGTACTTCTGCATGAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-347s1c1
Sequence:CCGGCCAACCGAAGAGAACTTCCTTCTCGAGAAGGAAGTTCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-538s1c1
Sequence:CCGGCCAAACCATACTACGGATGTTCTCGAGAACATCCGTAGTATGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001740
CALB2 MISSION shRNA Lentiviral Transduction Particles
calbindin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001740.3-1172s21c1
Sequence:CCGGAGCTCCCTCGCTGTATGATTTCTCGAGAAATCATACAGCGAGGGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-157s21c1
Sequence:CCGGCGCAGACGGAAATGGGTATATCTCGAGATATACCCATTTCCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001740.3-668s21c1
Sequence:CCGGTTTAACGCGATCTTCACATTTCTCGAGAAATGTGAAGATCGCGTTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-133s1c1
Sequence:CCGGCCTGGAAATATGGAAGCACTTCTCGAGAAGTGCTTCCATATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-694s1c1
Sequence:CCGGCAAGGATAGAAGCGGCTACATCTCGAGATGTAGCCGCTTCTATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-274s1c1
Sequence:CCGGGAAGGAGTTCATGCAGAAGTACTCGAGTACTTCTGCATGAACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-347s1c1
Sequence:CCGGCCAACCGAAGAGAACTTCCTTCTCGAGAAGGAAGTTCTCTTCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001740.2-538s1c1
Sequence:CCGGCCAAACCATACTACGGATGTTCTCGAGAACATCCGTAGTATGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007586
CALB2 MISSION shRNA Bacterial Glycerol Stock
calbindin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007586.1-1262s1c1
Sequence:CCGGCCCACCAGCTTGCTTAATGATCTCGAGATCATTAAGCAAGCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-346s1c1
Sequence:CCGGCCGACCGAAGAGAATTTCCTTCTCGAGAAGGAAATTCTCTTCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-157s1c1
Sequence:CCGGGCTGACGGAAATGGGTACATTCTCGAGAATGTACCCATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-240s1c1
Sequence:CCGGGATGTCCAAGAGCGACAATTTCTCGAGAAATTGTCGCTCTTGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-156s1c1
Sequence:CCGGTGCTGACGGAAATGGGTACATCTCGAGATGTACCCATTTCCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007586
CALB2 MISSION shRNA shRNA Plasmid DNA
calbindin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007586.1-1262s1c1
Sequence:CCGGCCCACCAGCTTGCTTAATGATCTCGAGATCATTAAGCAAGCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-346s1c1
Sequence:CCGGCCGACCGAAGAGAATTTCCTTCTCGAGAAGGAAATTCTCTTCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-157s1c1
Sequence:CCGGGCTGACGGAAATGGGTACATTCTCGAGAATGTACCCATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-240s1c1
Sequence:CCGGGATGTCCAAGAGCGACAATTTCTCGAGAAATTGTCGCTCTTGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-156s1c1
Sequence:CCGGTGCTGACGGAAATGGGTACATCTCGAGATGTACCCATTTCCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007586
CALB2 MISSION shRNA Lentiviral Transduction Particles
calbindin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104815    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007586.1-1262s1c1
Sequence:CCGGCCCACCAGCTTGCTTAATGATCTCGAGATCATTAAGCAAGCTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-346s1c1
Sequence:CCGGCCGACCGAAGAGAATTTCCTTCTCGAGAAGGAAATTCTCTTCGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-157s1c1
Sequence:CCGGGCTGACGGAAATGGGTACATTCTCGAGAATGTACCCATTTCCGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-240s1c1
Sequence:CCGGGATGTCCAAGAGCGACAATTTCTCGAGAAATTGTCGCTCTTGGACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007586.1-156s1c1
Sequence:CCGGTGCTGACGGAAATGGGTACATCTCGAGATGTACCCATTTCCGTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks