EMAIL THIS PAGE TO A FRIEND

CALCA

calcitonin-related polypeptide alpha

157 Gene Product Result for
Synonyms: CALC1 CGRP CGRP-I CGRP1 CT KC
UniProtKB ID: P06881, Q93048, Q9UCP0
Gene ID:
Human(796) Summary: This gene encodes the peptide hormones calcitonin, calcitonin gene-related peptide and katacalcin by tissue-specific alternative RNA splicing of the gene transcripts and cleavage of inactive precursor proteins. Calcitonin is involved in calcium regulation and acts to regulate phosphorus metabolism. Calcitonin gene-related peptide functions as a vasodilator while katacalcin is a calcium-lowering peptide. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
Mouse(12310) calcitonin/calcitonin-related polypeptide, alpha
Rat(24241) calcitonin-related polypeptide alpha
Zebrafish(436744) calcitonin/calcitonin-related polypeptide, alpha
cow(614663) calcitonin-related polypeptide alpha
Horse(100033906) calcitonin-related polypeptide alpha
chicken(396256) calcitonin
dog(403946) calcitonin-related polypeptide alpha
naked mole-rat(101725159) calcitonin-related polypeptide alpha
domestic guinea pig(100715216) calcitonin-related polypeptide alpha
sheep(100294596) calcitonin-related polypeptide alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001741 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001741 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001741 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007587 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007587 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007587 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU125061 MISSION® esiRNA esiRNA human CALCA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033952 Rosetta Predictions human pricing
NM_001033953 Rosetta Predictions human pricing
NM_001741 Rosetta Predictions human pricing
NM_001033955 Rosetta Predictions rat pricing
NM_001033956 Rosetta Predictions rat pricing
NM_017338 Rosetta Predictions rat pricing
NM_001033954 Rosetta Predictions mouse pricing
NM_007587 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209786 predicted 485
2 SASI_Hs01_00209787 predicted 312
3 SASI_Hs01_00209788 predicted 452
4 SASI_Hs01_00209789 predicted 322
5 SASI_Hs01_00209790 predicted 454
6 SASI_Hs01_00209792 predicted 453
7 SASI_Hs02_00308117 predicted 335
8 SASI_Hs01_00209793 predicted 368
9 SASI_Hs01_00209795 predicted 541
10 SASI_Hs02_00308118 predicted 553
11 SASI_Hs01_00209791 predicted 536
12 SASI_Hs01_00209794 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108681 predicted 597
2 SASI_Hs01_00108682 predicted 530
3 SASI_Hs01_00108683 predicted 637
4 SASI_Hs02_00308119 predicted 278
5 SASI_Hs01_00108684 predicted 629
6 SASI_Hs01_00108685 predicted 626
7 SASI_Hs01_00108686 predicted 480
8 SASI_Hs01_00108689 predicted 542
9 SASI_Hs02_00308120 predicted 457
10 SASI_Hs02_00308121 predicted 461
11 SASI_Hs01_00108687 predicted 380
12 SASI_Hs01_00108688 predicted 331
13 SASI_Hs01_00108690 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001741 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193055 predicted 470
2 SASI_Hs01_00193056 predicted 285
3 SASI_Hs01_00193057 predicted 430
4 SASI_Hs01_00193058 predicted 304
5 SASI_Hs01_00193059 predicted 433
6 SASI_Hs01_00193061 predicted 435
7 SASI_Hs02_00332457 predicted 313
8 SASI_Hs01_00193062 predicted 338
9 SASI_Hs01_00193064 predicted 510
10 SASI_Hs02_00332458 predicted 527
11 SASI_Hs01_00193060 predicted 505
12 SASI_Hs01_00193063 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033955 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033035 predicted 596
2 SASI_Rn01_00033036 predicted 748
3 SASI_Rn01_00033037 predicted 709
4 SASI_Rn01_00033038 predicted 539
5 SASI_Rn01_00033039 predicted 675
6 SASI_Rn01_00033040 predicted 654
7 SASI_Rn01_00033041 predicted 715
8 SASI_Rn01_00033042 predicted 595
9 SASI_Rn01_00033043 predicted 726
10 SASI_Rn01_00033044 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084769 predicted 579
2 SASI_Rn01_00084770 predicted 725
3 SASI_Rn01_00084771 predicted 687
4 SASI_Rn01_00084772 predicted 508
5 SASI_Rn01_00084773 predicted 652
6 SASI_Rn01_00084774 predicted 626
7 SASI_Rn01_00084775 predicted 696
8 SASI_Rn01_00084776 predicted 574
9 SASI_Rn01_00084777 predicted 697
10 SASI_Rn01_00084778 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046628 predicted 206
2 SASI_Rn01_00046629 predicted 387
3 SASI_Rn01_00046630 predicted 249
4 SASI_Rn02_00261795 predicted 216
5 SASI_Rn01_00046631 predicted 266
6 SASI_Rn02_00261796 predicted 359
7 SASI_Rn01_00046633 predicted 242
8 SASI_Rn01_00046634 predicted 349
9 SASI_Rn01_00046637 predicted 383
10 SASI_Rn02_00261797 predicted 311
11 SASI_Rn01_00046632 predicted 393
12 SASI_Rn01_00046635 predicted 220
13 SASI_Rn01_00046636 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082909 predicted 673
2 SASI_Mm01_00082910 predicted 741
3 SASI_Mm02_00289042 predicted 763
4 SASI_Mm02_00289043 predicted 523
5 SASI_Mm01_00082911 predicted 675
6 SASI_Mm01_00082912 predicted 732
7 SASI_Mm01_00082914 predicted 622
8 SASI_Mm01_00082915 predicted 601
9 SASI_Mm01_00082916 predicted 650
10 SASI_Mm01_00082917 predicted 592
11 SASI_Mm01_00082913 predicted 581
12 SASI_Mm01_00082918 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007587 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055232 predicted 535
2 SASI_Mm01_00055233 predicted 514
3 SASI_Mm01_00055234 predicted 644
4 SASI_Mm01_00055235 predicted 396
5 SASI_Mm01_00055236 predicted 436
6 SASI_Mm01_00055237 predicted 488
7 SASI_Mm01_00055238 predicted 624
8 SASI_Mm01_00055239 predicted 311
9 SASI_Mm01_00055240 predicted 630
10 SASI_Mm01_00055241 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001741
CALCA MISSION shRNA Bacterial Glycerol Stock
calcitonin-related polypeptide alpha
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001741.1-521s1c1
Sequence:CCGGCCCTTCTTGCATCCTTCCTATCTCGAGATAGGAAGGATGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-309s1c1
Sequence:CCGGCCAGATCTAAGCGGTGCGGTACTCGAGTACCGCACCGCTTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-449s1c1
Sequence:CCGGGAGAGAGACCATCGCCCTCATCTCGAGATGAGGGCGATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-367s1c1
Sequence:CCGGCTTCAACAAGTTTCACACGTTCTCGAGAACGTGTGAAACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-325s1c1
Sequence:CCGGCGGTAATCTGAGTACTTGCATCTCGAGATGCAAGTACTCAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001741.2-480s21c1
Sequence:CCGGTCCTCCCTTTCCTTCCTAATTCTCGAGAATTAGGAAGGAAAGGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001741
CALCA MISSION shRNA shRNA Plasmid DNA
calcitonin-related polypeptide alpha
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001741.1-521s1c1
Sequence:CCGGCCCTTCTTGCATCCTTCCTATCTCGAGATAGGAAGGATGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-309s1c1
Sequence:CCGGCCAGATCTAAGCGGTGCGGTACTCGAGTACCGCACCGCTTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-449s1c1
Sequence:CCGGGAGAGAGACCATCGCCCTCATCTCGAGATGAGGGCGATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-367s1c1
Sequence:CCGGCTTCAACAAGTTTCACACGTTCTCGAGAACGTGTGAAACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-325s1c1
Sequence:CCGGCGGTAATCTGAGTACTTGCATCTCGAGATGCAAGTACTCAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001741.2-480s21c1
Sequence:CCGGTCCTCCCTTTCCTTCCTAATTCTCGAGAATTAGGAAGGAAAGGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001741
CALCA MISSION shRNA Lentiviral Transduction Particles
calcitonin-related polypeptide alpha
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001741.1-521s1c1
Sequence:CCGGCCCTTCTTGCATCCTTCCTATCTCGAGATAGGAAGGATGCAAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-309s1c1
Sequence:CCGGCCAGATCTAAGCGGTGCGGTACTCGAGTACCGCACCGCTTAGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-449s1c1
Sequence:CCGGGAGAGAGACCATCGCCCTCATCTCGAGATGAGGGCGATGGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-367s1c1
Sequence:CCGGCTTCAACAAGTTTCACACGTTCTCGAGAACGTGTGAAACTTGTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001741.1-325s1c1
Sequence:CCGGCGGTAATCTGAGTACTTGCATCTCGAGATGCAAGTACTCAGATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001741.2-480s21c1
Sequence:CCGGTCCTCCCTTTCCTTCCTAATTCTCGAGAATTAGGAAGGAAAGGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007587
CALCA MISSION shRNA Bacterial Glycerol Stock
calcitonin-related polypeptide alpha
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000184797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-370s1c1
Sequence:CCGGCGTACACACAAGACCTCAACACTCGAGTGTTGAGGTCTTGTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-344s1c1
Sequence:CCGGGAATCTGAGTACCTGCATGCTCTCGAGAGCATGCAGGTACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-575s1c1
Sequence:CCGGCCAGGCTATTACTGGTTGCTTCTCGAGAAGCAACCAGTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-521s1c1
Sequence:CCGGCCTTCTTGCTTTCTTCCTATACTCGAGTATAGGAAGAAAGCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007587
CALCA MISSION shRNA shRNA Plasmid DNA
calcitonin-related polypeptide alpha
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000184797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-370s1c1
Sequence:CCGGCGTACACACAAGACCTCAACACTCGAGTGTTGAGGTCTTGTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-344s1c1
Sequence:CCGGGAATCTGAGTACCTGCATGCTCTCGAGAGCATGCAGGTACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-575s1c1
Sequence:CCGGCCAGGCTATTACTGGTTGCTTCTCGAGAAGCAACCAGTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-521s1c1
Sequence:CCGGCCTTCTTGCTTTCTTCCTATACTCGAGTATAGGAAGAAAGCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007587
CALCA MISSION shRNA Lentiviral Transduction Particles
calcitonin-related polypeptide alpha
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000184797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-370s1c1
Sequence:CCGGCGTACACACAAGACCTCAACACTCGAGTGTTGAGGTCTTGTGTGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007587.1-344s1c1
Sequence:CCGGGAATCTGAGTACCTGCATGCTCTCGAGAGCATGCAGGTACTCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184027    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-575s1c1
Sequence:CCGGCCAGGCTATTACTGGTTGCTTCTCGAGAAGCAACCAGTAATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007587.1-521s1c1
Sequence:CCGGCCTTCTTGCTTTCTTCCTATACTCGAGTATAGGAAGAAAGCAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks