EMAIL THIS PAGE TO A FRIEND

CALCB

calcitonin-related polypeptide beta

51 Gene Product Result for
Synonyms: CALC2 CGRP-II CGRP2
UniProtKB ID: P10092, A8K573, D3DQX4, Q569I0, Q9UCN9
Gene ID:
Mouse(116903) calcitonin-related polypeptide, beta
Rat(171519) calcitonin-related polypeptide, beta
sheep(100170328) calcitonin-related polypeptide beta
domestic guinea pig(100715671) calcitonin-related polypeptide beta
naked mole-rat(101725809) calcitonin-related polypeptide beta
cow(407218) calcitonin-related polypeptide beta
dog(403415) calcitonin-related polypeptide beta
Horse(100034126) calcitonin-related polypeptide beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412692 Anti-CALCB antibody produced in mouse purified immunoglobulin, 0.43 mg/mL human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054084 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054084 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054084 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000728 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032941 MISSION® esiRNA esiRNA human CALCB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000728 Rosetta Predictions human pricing
NM_138513 Rosetta Predictions rat pricing
NM_054084 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085976 predicted 691
2 SASI_Hs01_00085977 predicted 606
3 SASI_Hs01_00085978 predicted 639
4 SASI_Hs01_00085979 predicted 638
5 SASI_Hs01_00085980 predicted 564
6 SASI_Hs01_00085981 predicted 738
7 SASI_Hs01_00085982 predicted 725
8 SASI_Hs01_00085983 predicted 468
9 SASI_Hs01_00085984 predicted 694
10 SASI_Hs01_00085985 predicted 730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105583 predicted 346
2 SASI_Rn01_00105584 predicted 500
3 SASI_Rn01_00105585 predicted 420
4 SASI_Rn01_00105586 predicted 508
5 SASI_Rn02_00268112 predicted 404
6 SASI_Rn01_00105589 predicted 403
7 SASI_Rn01_00105590 predicted 437
8 SASI_Rn01_00105591 predicted 396
9 SASI_Rn01_00105592 predicted 424
10 SASI_Rn02_00268113 predicted 425
11 SASI_Rn01_00105587 predicted 427
12 SASI_Rn01_00105588 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054084 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338009 predicted 549
2 SASI_Mm01_00063533 predicted 514
3 SASI_Mm01_00063534 predicted 547
4 SASI_Mm02_00338010 predicted 612
5 SASI_Mm02_00338011 predicted 690
6 SASI_Mm02_00338012 predicted 645
7 SASI_Mm02_00338013 predicted 633
8 SASI_Mm02_00338014 predicted 625
9 SASI_Mm01_00063537 predicted 516
10 SASI_Mm02_00338015 predicted 717
11 SASI_Mm01_00063535 predicted 595
12 SASI_Mm01_00063536 predicted 593
13 SASI_Mm01_00063538 predicted 503
14 SASI_Mm01_00063539 predicted 531
15 SASI_Mm01_00063540 predicted 508
16 SASI_Mm01_00063541 predicted 598
17 SASI_Mm01_00063542 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054084
CALCB MISSION shRNA Bacterial Glycerol Stock
calcitonin-related polypeptide beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054084.1-623s1c1
Sequence:CCGGCCGTTGTTACTTGAGAGGAATCTCGAGATTCCTCTCAAGTAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-258s1c1
Sequence:CCGGGCAGGACTATGAGCAGATGAACTCGAGTTCATCTGCTCATAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-174s1c1
Sequence:CCGGCCCTTTCAGGTCCGCTTTGGACTCGAGTCCAAAGCGGACCTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-320s1c1
Sequence:CCGGCCCGTGTCACTGCTCAGAAGACTCGAGTCTTCTGAGCAGTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-402s1c1
Sequence:CCGGAGGTGTGCTGAAGGACAACTTCTCGAGAAGTTGTCCTTCAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054084
CALCB MISSION shRNA shRNA Plasmid DNA
calcitonin-related polypeptide beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054084.1-623s1c1
Sequence:CCGGCCGTTGTTACTTGAGAGGAATCTCGAGATTCCTCTCAAGTAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-258s1c1
Sequence:CCGGGCAGGACTATGAGCAGATGAACTCGAGTTCATCTGCTCATAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-174s1c1
Sequence:CCGGCCCTTTCAGGTCCGCTTTGGACTCGAGTCCAAAGCGGACCTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-320s1c1
Sequence:CCGGCCCGTGTCACTGCTCAGAAGACTCGAGTCTTCTGAGCAGTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-402s1c1
Sequence:CCGGAGGTGTGCTGAAGGACAACTTCTCGAGAAGTTGTCCTTCAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054084
CALCB MISSION shRNA Lentiviral Transduction Particles
calcitonin-related polypeptide beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054084.1-623s1c1
Sequence:CCGGCCGTTGTTACTTGAGAGGAATCTCGAGATTCCTCTCAAGTAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-258s1c1
Sequence:CCGGGCAGGACTATGAGCAGATGAACTCGAGTTCATCTGCTCATAGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-174s1c1
Sequence:CCGGCCCTTTCAGGTCCGCTTTGGACTCGAGTCCAAAGCGGACCTGAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-320s1c1
Sequence:CCGGCCCGTGTCACTGCTCAGAAGACTCGAGTCTTCTGAGCAGTGACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054084.1-402s1c1
Sequence:CCGGAGGTGTGCTGAAGGACAACTTCTCGAGAAGTTGTCCTTCAGCACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000728
CALCB MISSION shRNA Bacterial Glycerol Stock
calcitonin-related polypeptide beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-643s1c1
Sequence:CCGGCCATATTTGCTGTGCATCATTCTCGAGAATGATGCACAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-717s1c1
Sequence:CCGGCTGGTAGCAAACTGGTTCTTTCTCGAGAAAGAACCAGTTTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-461s1c1
Sequence:CCGGGATGAATGACTCCAGGAAGAACTCGAGTTCTTCCTGGAGTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-547s1c1
Sequence:CCGGCCCGTGGAAGATACACATGTTCTCGAGAACATGTGTATCTTCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-107s1c1
Sequence:CCGGCTCAGTATCTTGGTCCTGTACCTCGAGGTACAGGACCAAGATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-236s1c1
Sequence:CCGGCAGGACTATGTGCAGATGAAGCTCGAGCTTCATCTGCACATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-379s1c1
Sequence:CCGGCATGGTGAAGAGCAACTTCGTCTCGAGACGAAGTTGCTCTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-458s1c1
Sequence:CCGGGCAGATGAATGACTCCAGGAACTCGAGTTCCTGGAGTCATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-488s1c1
Sequence:CCGGCATGAAACTGAACTCACCATTCTCGAGAATGGTGAGTTCAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-596s1c1
Sequence:CCGGCCTTTGTCACTTGAAAGGAATCTCGAGATTCCTTTCAAGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000728
CALCB MISSION shRNA shRNA Plasmid DNA
calcitonin-related polypeptide beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-643s1c1
Sequence:CCGGCCATATTTGCTGTGCATCATTCTCGAGAATGATGCACAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-717s1c1
Sequence:CCGGCTGGTAGCAAACTGGTTCTTTCTCGAGAAAGAACCAGTTTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-461s1c1
Sequence:CCGGGATGAATGACTCCAGGAAGAACTCGAGTTCTTCCTGGAGTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-547s1c1
Sequence:CCGGCCCGTGGAAGATACACATGTTCTCGAGAACATGTGTATCTTCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-107s1c1
Sequence:CCGGCTCAGTATCTTGGTCCTGTACCTCGAGGTACAGGACCAAGATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-236s1c1
Sequence:CCGGCAGGACTATGTGCAGATGAAGCTCGAGCTTCATCTGCACATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-379s1c1
Sequence:CCGGCATGGTGAAGAGCAACTTCGTCTCGAGACGAAGTTGCTCTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-458s1c1
Sequence:CCGGGCAGATGAATGACTCCAGGAACTCGAGTTCCTGGAGTCATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-488s1c1
Sequence:CCGGCATGAAACTGAACTCACCATTCTCGAGAATGGTGAGTTCAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-596s1c1
Sequence:CCGGCCTTTGTCACTTGAAAGGAATCTCGAGATTCCTTTCAAGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000728
CALCB MISSION shRNA Lentiviral Transduction Particles
calcitonin-related polypeptide beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143977    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-643s1c1
Sequence:CCGGCCATATTTGCTGTGCATCATTCTCGAGAATGATGCACAGCAAATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142323    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-717s1c1
Sequence:CCGGCTGGTAGCAAACTGGTTCTTTCTCGAGAAAGAACCAGTTTGCTACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141887    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-461s1c1
Sequence:CCGGGATGAATGACTCCAGGAAGAACTCGAGTTCTTCCTGGAGTCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-547s1c1
Sequence:CCGGCCCGTGGAAGATACACATGTTCTCGAGAACATGTGTATCTTCCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-107s1c1
Sequence:CCGGCTCAGTATCTTGGTCCTGTACCTCGAGGTACAGGACCAAGATACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-236s1c1
Sequence:CCGGCAGGACTATGTGCAGATGAAGCTCGAGCTTCATCTGCACATAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139318    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000728.3-379s1c1
Sequence:CCGGCATGGTGAAGAGCAACTTCGTCTCGAGACGAAGTTGCTCTTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-458s1c1
Sequence:CCGGGCAGATGAATGACTCCAGGAACTCGAGTTCCTGGAGTCATTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144465    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_000728.3-488s1c1
Sequence:CCGGCATGAAACTGAACTCACCATTCTCGAGAATGGTGAGTTCAGTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000728.3-596s1c1
Sequence:CCGGCCTTTGTCACTTGAAAGGAATCTCGAGATTCCTTTCAAGTGACAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks