EMAIL THIS PAGE TO A FRIEND

CALCOCO1

calcium binding and coiled-coil domain 1

186 Gene Product Result for
Synonyms: Cocoa calphoglin
Gene ID:
Mouse(67488) calcium binding and coiled coil domain 1
Rat(246047) calcium binding and coiled coil domain 1
domestic guinea pig(100729752) calcium binding and coiled-coil domain 1
naked mole-rat(101705553) calcium binding and coiled-coil domain 1
sheep(101122936) calcium binding and coiled-coil domain 1
Domestic Rabbit(100337884) calcium binding and coiled-coil domain 1
Zebrafish(334971) calcium binding and coiled-coil domain 1
cow(538675) calcium binding and coiled-coil domain 1
domestic cat(101088853) calcium binding and coiled-coil domain 1
Horse(100064155) calcium binding and coiled-coil domain 1
dog(486505) calcium binding and coiled-coil domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078691 MISSION® esiRNA esiRNA human CALCOCO1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020898 Rosetta Predictions human pricing
NM_139190 Rosetta Predictions rat pricing
NM_026192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062280 predicted 1319
2 SASI_Hs01_00062281 predicted 1904
3 SASI_Hs01_00062282 predicted 1531
4 SASI_Hs01_00062283 predicted 1438
5 SASI_Hs02_00354222 predicted 1342
6 SASI_Hs01_00062284 predicted 1532
7 SASI_Hs02_00354223 predicted 1453
8 SASI_Hs01_00062285 predicted 533
9 SASI_Hs02_00354224 predicted 1896
10 SASI_Hs01_00062287 predicted 228
11 SASI_Hs01_00062279 predicted 777
12 SASI_Hs01_00062286 predicted 935
13 SASI_Hs01_00062288 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139190 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107489 predicted 1357
2 SASI_Rn01_00107491 predicted 808
3 SASI_Rn02_00268521 predicted 1342
4 SASI_Rn01_00107493 predicted 256
5 SASI_Rn01_00107494 predicted 1486
6 SASI_Rn01_00107495 predicted 1879
7 SASI_Rn01_00107496 predicted 497
8 SASI_Rn01_00107497 predicted 1457
9 SASI_Rn01_00107498 predicted 265
10 SASI_Rn02_00268522 predicted 1630
11 SASI_Rn01_00107490 predicted 565
12 SASI_Rn01_00107492 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193270 predicted 915
2 SASI_Mm01_00193271 predicted 1589
3 SASI_Mm01_00193272 predicted 721
4 SASI_Mm01_00193273 predicted 448
5 SASI_Mm01_00193274 predicted 1503
6 SASI_Mm01_00193275 predicted 195
7 SASI_Mm01_00193276 predicted 240
8 SASI_Mm01_00193277 predicted 1574
9 SASI_Mm01_00193278 predicted 1838
10 SASI_Mm01_00193279 predicted 877
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020898
CALCOCO1 MISSION shRNA Bacterial Glycerol Stock
calcium binding and coiled-coil domain 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2151s1c1
Sequence:CCGGGCACAAATACACACTCATGCACTCGAGTGCATGAGTGTGTATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2701s1c1
Sequence:CCGGCATAACCTTAGGTATTCAGTTCTCGAGAACTGAATACCTAAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1343s1c1
Sequence:CCGGGAGTGCAGAGATACTTCGATTCTCGAGAATCGAAGTATCTCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1425s1c1
Sequence:CCGGGAGAAGGATTCTAGCCTGGTACTCGAGTACCAGGCTAGAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-1942s21c1
Sequence:CCGGATGACATGGCCAGTGGCTTTACTCGAGTAAAGCCACTGGCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-927s21c1
Sequence:CCGGCAGGAGAACCATCACTTAAATCTCGAGATTTAAGTGATGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020898.1-2527s21c1
Sequence:CCGGGCACCCTACCCTCTCTTATTTCTCGAGAAATAAGAGAGGGTAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-2118s21c1
Sequence:CCGGTTCACCTTTGAGTGATCTTACCTCGAGGTAAGATCACTCAAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-343s21c1
Sequence:CCGGAGCTCTACCAGTTCCGATATGCTCGAGCATATCGGAACTGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020898
CALCOCO1 MISSION shRNA shRNA Plasmid DNA
calcium binding and coiled-coil domain 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2151s1c1
Sequence:CCGGGCACAAATACACACTCATGCACTCGAGTGCATGAGTGTGTATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2701s1c1
Sequence:CCGGCATAACCTTAGGTATTCAGTTCTCGAGAACTGAATACCTAAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1343s1c1
Sequence:CCGGGAGTGCAGAGATACTTCGATTCTCGAGAATCGAAGTATCTCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1425s1c1
Sequence:CCGGGAGAAGGATTCTAGCCTGGTACTCGAGTACCAGGCTAGAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-1942s21c1
Sequence:CCGGATGACATGGCCAGTGGCTTTACTCGAGTAAAGCCACTGGCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-927s21c1
Sequence:CCGGCAGGAGAACCATCACTTAAATCTCGAGATTTAAGTGATGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020898.1-2527s21c1
Sequence:CCGGGCACCCTACCCTCTCTTATTTCTCGAGAAATAAGAGAGGGTAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-2118s21c1
Sequence:CCGGTTCACCTTTGAGTGATCTTACCTCGAGGTAAGATCACTCAAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-343s21c1
Sequence:CCGGAGCTCTACCAGTTCCGATATGCTCGAGCATATCGGAACTGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020898
CALCOCO1 MISSION shRNA Lentiviral Transduction Particles
calcium binding and coiled-coil domain 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168283    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2151s1c1
Sequence:CCGGGCACAAATACACACTCATGCACTCGAGTGCATGAGTGTGTATTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166850    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020898.1-2701s1c1
Sequence:CCGGCATAACCTTAGGTATTCAGTTCTCGAGAACTGAATACCTAAGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1343s1c1
Sequence:CCGGGAGTGCAGAGATACTTCGATTCTCGAGAATCGAAGTATCTCTGCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020898.1-1425s1c1
Sequence:CCGGGAGAAGGATTCTAGCCTGGTACTCGAGTACCAGGCTAGAATCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-1942s21c1
Sequence:CCGGATGACATGGCCAGTGGCTTTACTCGAGTAAAGCCACTGGCCATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-927s21c1
Sequence:CCGGCAGGAGAACCATCACTTAAATCTCGAGATTTAAGTGATGGTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020898.1-2527s21c1
Sequence:CCGGGCACCCTACCCTCTCTTATTTCTCGAGAAATAAGAGAGGGTAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-2118s21c1
Sequence:CCGGTTCACCTTTGAGTGATCTTACCTCGAGGTAAGATCACTCAAAGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020898.1-343s21c1
Sequence:CCGGAGCTCTACCAGTTCCGATATGCTCGAGCATATCGGAACTGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026192
CALCOCO1 MISSION shRNA Bacterial Glycerol Stock
calcium binding and coiled-coil domain 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-897s1c1
Sequence:CCGGGCTGAATTACAAACGGTCCGACTCGAGTCGGACCGTTTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-1754s1c1
Sequence:CCGGGCCTTCTTCTCTTGTTGTCATCTCGAGATGACAACAAGAGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-282s21c1
Sequence:CCGGACCCATGCCAGTGTCCAATTCCTCGAGGAATTGGACACTGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026192.2-2405s21c1
Sequence:CCGGCCTTGCGGGAATAGAATTATTCTCGAGAATAATTCTATTCCCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-209s21c1
Sequence:CCGGAGCTGCCTGCGTTCGAGATTACTCGAGTAATCTCGAACGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-918s21c1
Sequence:CCGGGAGGAGAACTGCTGCTTAAATCTCGAGATTTAAGCAGCAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026192
CALCOCO1 MISSION shRNA shRNA Plasmid DNA
calcium binding and coiled-coil domain 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-897s1c1
Sequence:CCGGGCTGAATTACAAACGGTCCGACTCGAGTCGGACCGTTTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-1754s1c1
Sequence:CCGGGCCTTCTTCTCTTGTTGTCATCTCGAGATGACAACAAGAGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-282s21c1
Sequence:CCGGACCCATGCCAGTGTCCAATTCCTCGAGGAATTGGACACTGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026192.2-2405s21c1
Sequence:CCGGCCTTGCGGGAATAGAATTATTCTCGAGAATAATTCTATTCCCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-209s21c1
Sequence:CCGGAGCTGCCTGCGTTCGAGATTACTCGAGTAATCTCGAACGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-918s21c1
Sequence:CCGGGAGGAGAACTGCTGCTTAAATCTCGAGATTTAAGCAGCAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026192
CALCOCO1 MISSION shRNA Lentiviral Transduction Particles
calcium binding and coiled-coil domain 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-897s1c1
Sequence:CCGGGCTGAATTACAAACGGTCCGACTCGAGTCGGACCGTTTGTAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026192.1-1754s1c1
Sequence:CCGGGCCTTCTTCTCTTGTTGTCATCTCGAGATGACAACAAGAGAAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-282s21c1
Sequence:CCGGACCCATGCCAGTGTCCAATTCCTCGAGGAATTGGACACTGGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026192.2-2405s21c1
Sequence:CCGGCCTTGCGGGAATAGAATTATTCTCGAGAATAATTCTATTCCCGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-209s21c1
Sequence:CCGGAGCTGCCTGCGTTCGAGATTACTCGAGTAATCTCGAACGCAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026192.2-918s21c1
Sequence:CCGGGAGGAGAACTGCTGCTTAAATCTCGAGATTTAAGCAGCAGTTCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks