EMAIL THIS PAGE TO A FRIEND

CALCOCO2

calcium binding and coiled-coil domain 2

145 Gene Product Result for
Synonyms: NDP52
Gene ID:
Human(10241) Summary: This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a receptor for ubiquitin-coated bacteria and plays an important role in innate immunity by mediating macroautophagy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(76815) calcium binding and coiled-coil domain 2
Rat(303479) calcium binding and coiled-coil domain 2
Zebrafish(553776) calcium binding and coiled-coil domain 2
cow(281942) calcium binding and coiled-coil domain 2
Horse(100055791) calcium binding and coiled-coil domain 2
domestic cat(101097685) calcium binding and coiled-coil domain 2
dog(480545) calcium binding and coiled-coil domain 2
chicken(419993) calcium binding and coiled-coil domain 2
sheep(101114034) calcium binding and coiled-coil domain 2
Domestic Rabbit(100351096) calcium binding and coiled-coil domain 2
naked mole-rat(101715405) calcium binding and coiled-coil domain 2
domestic guinea pig(100719119) calcium binding and coiled-coil domain 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001100177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001100177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001100177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005831 Rosetta Predictions human pricing
XM_001081333 Rosetta Predictions rat pricing
XM_220903 Rosetta Predictions rat pricing
NM_001100177 Rosetta Predictions mouse pricing
NM_029755 Rosetta Predictions mouse pricing
XM_203409 Rosetta Predictions mouse pricing
XM_992279 Rosetta Predictions mouse pricing
XM_992355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137944 predicted 275
2 SASI_Hs01_00137945 predicted 1458
3 SASI_Hs01_00137946 predicted 1091
4 SASI_Hs01_00137947 predicted 810
5 SASI_Hs01_00137948 predicted 1109
6 SASI_Hs01_00137949 predicted 1037
7 SASI_Hs01_00137950 predicted 1283
8 SASI_Hs01_00137951 predicted 1487
9 SASI_Hs01_00137952 predicted 1148
10 SASI_Hs01_00137953 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371469 predicted 391
2 SASI_Rn02_00371470 predicted 338
3 SASI_Rn02_00371471 predicted 462
4 SASI_Rn02_00371472 predicted 1011
5 SASI_Rn02_00371473 predicted 460
6 SASI_Rn02_00371474 predicted 750
7 SASI_Rn02_00371475 predicted 717
8 SASI_Rn02_00371476 predicted 1082
9 SASI_Rn02_00371477 predicted 326
10 SASI_Rn02_00371478 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379629 predicted 395
2 SASI_Rn02_00379630 predicted 346
3 SASI_Rn02_00379631 predicted 461
4 SASI_Rn02_00379632 predicted 1016
5 SASI_Rn02_00379633 predicted 459
6 SASI_Rn02_00379634 predicted 745
7 SASI_Rn02_00379635 predicted 717
8 SASI_Rn02_00379636 predicted 1091
9 SASI_Rn02_00379637 predicted 328
10 SASI_Rn02_00379638 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302125 predicted 1109
2 SASI_Mm02_00302126 predicted 855
3 SASI_Mm02_00302127 predicted 197
4 SASI_Mm02_00302128 predicted 326
5 SASI_Mm02_00302129 predicted 207
6 SASI_Mm02_00302130 predicted 301
7 SASI_Mm02_00302131 predicted 848
8 SASI_Mm02_00302132 predicted 208
9 SASI_Mm02_00302133 predicted 405
10 SASI_Mm02_00302134 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335875 predicted 1255
2 SASI_Mm02_00335876 predicted 998
3 SASI_Mm02_00335877 predicted 204
4 SASI_Mm02_00335878 predicted 325
5 SASI_Mm02_00335879 predicted 200
6 SASI_Mm02_00335880 predicted 296
7 SASI_Mm02_00335881 predicted 994
8 SASI_Mm02_00335882 predicted 214
9 SASI_Mm02_00335883 predicted 410
10 SASI_Mm02_00335884 predicted 1180
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268595 predicted 208
2 SASI_Mm01_00268596 predicted 428
3 SASI_Mm01_00268597 predicted 338
4 SASI_Mm01_00268598 predicted 205
5 SASI_Mm01_00268599 predicted 307
6 SASI_Mm01_00268600 predicted 216
7 SASI_Mm01_00268601 predicted 408
8 SASI_Mm01_00268602 predicted 1186
9 SASI_Mm01_00268603 predicted 344
10 SASI_Mm01_00268604 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229378 predicted 209
2 SASI_Mm01_00229379 predicted 341
3 SASI_Mm01_00229380 predicted 208
4 SASI_Mm01_00229381 predicted 309
5 SASI_Mm01_00229382 predicted 215
6 SASI_Mm01_00229383 predicted 955
7 SASI_Mm01_00229384 predicted 344
8 SASI_Mm01_00229385 predicted 383
9 SASI_Mm01_00229386 predicted 1020
10 SASI_Mm01_00229387 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_992355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237512 predicted 212
2 SASI_Mm01_00237513 predicted 420
3 SASI_Mm01_00237514 predicted 333
4 SASI_Mm01_00237515 predicted 213
5 SASI_Mm01_00237516 predicted 303
6 SASI_Mm01_00237517 predicted 217
7 SASI_Mm01_00237518 predicted 411
8 SASI_Mm01_00237519 predicted 979
9 SASI_Mm01_00237520 predicted 345
10 SASI_Mm01_00237521 predicted 373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005831
VALIDATED
CALCOCO2 MISSION shRNA Bacterial Glycerol Stock
calcium binding and coiled-coil domain 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-1728s21c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-701s21c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-386s21c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-2847s21c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-1197s1c1
Sequence:CCGGGACTTGCCTATGGAAACCCATCTCGAGATGGGTTTCCATAGGCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-1728s1c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-2847s1c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-701s1c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005831.3-949s1c1
Sequence:CCGGGCAGAATGAAACTACTGCAATCTCGAGATTGCAGTAGTTTCATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-386s1c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005831
VALIDATED
CALCOCO2 MISSION shRNA shRNA Plasmid DNA
calcium binding and coiled-coil domain 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-1728s21c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-701s21c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-386s21c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-2847s21c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-1197s1c1
Sequence:CCGGGACTTGCCTATGGAAACCCATCTCGAGATGGGTTTCCATAGGCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-1728s1c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-2847s1c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-701s1c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005831.3-949s1c1
Sequence:CCGGGCAGAATGAAACTACTGCAATCTCGAGATTGCAGTAGTTTCATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-386s1c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005831
VALIDATED
CALCOCO2 MISSION shRNA Lentiviral Transduction Particles
calcium binding and coiled-coil domain 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-1728s21c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-701s21c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005831.3-386s21c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280771    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005831.3-2847s21c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-1197s1c1
Sequence:CCGGGACTTGCCTATGGAAACCCATCTCGAGATGGGTTTCCATAGGCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-1728s1c1
Sequence:CCGGCCTGACTTGATACTAAGTGATCTCGAGATCACTTAGTATCAAGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-2847s1c1
Sequence:CCGGCCCTTTGTGAACTAAGTTCAACTCGAGTTGAACTTAGTTCACAAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005831.3-701s1c1
Sequence:CCGGGAGCTGCTTCAACTGAAAGAACTCGAGTTCTTTCAGTTGAAGCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005831.3-949s1c1
Sequence:CCGGGCAGAATGAAACTACTGCAATCTCGAGATTGCAGTAGTTTCATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005831.3-386s1c1
Sequence:CCGGGAGTATTACCAGTTCTGCTATCTCGAGATAGCAGAACTGGTAATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100177
CALCOCO2 MISSION shRNA Bacterial Glycerol Stock
calcium binding and coiled-coil domain 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-554s21c1
Sequence:CCGGAGCAACACAGAGGGTCAATAACTCGAGTTATTGACCCTCTGTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-126s21c1
Sequence:CCGGGGAGATATCATGTGCTATTACCTCGAGGTAATAGCACATGATATCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-291s21c1
Sequence:CCGGATCCAATTCAAAGCTTATTACCTCGAGGTAATAAGCTTTGAATTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100177.1-1085s21c1
Sequence:CCGGGCTGGCCAGACAGCTATATAGCTCGAGCTATATAGCTGTCTGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-211s21c1
Sequence:CCGGAGACCACTCAGGAGTATTATACTCGAGTATAATACTCCTGAGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100177
CALCOCO2 MISSION shRNA shRNA Plasmid DNA
calcium binding and coiled-coil domain 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-554s21c1
Sequence:CCGGAGCAACACAGAGGGTCAATAACTCGAGTTATTGACCCTCTGTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-126s21c1
Sequence:CCGGGGAGATATCATGTGCTATTACCTCGAGGTAATAGCACATGATATCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-291s21c1
Sequence:CCGGATCCAATTCAAAGCTTATTACCTCGAGGTAATAAGCTTTGAATTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100177.1-1085s21c1
Sequence:CCGGGCTGGCCAGACAGCTATATAGCTCGAGCTATATAGCTGTCTGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-211s21c1
Sequence:CCGGAGACCACTCAGGAGTATTATACTCGAGTATAATACTCCTGAGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100177
CALCOCO2 MISSION shRNA Lentiviral Transduction Particles
calcium binding and coiled-coil domain 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-554s21c1
Sequence:CCGGAGCAACACAGAGGGTCAATAACTCGAGTTATTGACCCTCTGTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-126s21c1
Sequence:CCGGGGAGATATCATGTGCTATTACCTCGAGGTAATAGCACATGATATCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-291s21c1
Sequence:CCGGATCCAATTCAAAGCTTATTACCTCGAGGTAATAAGCTTTGAATTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100177.1-1085s21c1
Sequence:CCGGGCTGGCCAGACAGCTATATAGCTCGAGCTATATAGCTGTCTGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100177.1-211s21c1
Sequence:CCGGAGACCACTCAGGAGTATTATACTCGAGTATAATACTCCTGAGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)