EMAIL THIS PAGE TO A FRIEND

CALCR

calcitonin receptor

213 Gene Product Result for
Synonyms: CRT CT-R CTR CTR1
UniProtKB ID: P30988, O14585, Q13941, Q6DJU8, Q6T712
Gene ID:
Human(799) Summary: This gene encodes a high affinity receptor for the peptide hormone calcitonin and belongs to a subfamily of seven transmembrane-spanning G protein-coupled receptors. The encoded protein is involved in maintaining calcium homeostasis and in regulating osteoclast-mediated bone resorption. Polymorphisms in this gene have been associated with variations in bone mineral density and onset of osteoporosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Mouse(12311) calcitonin receptor
Rat(116506) calcitonin receptor
Zebrafish(560268) calcitonin receptor
domestic cat(101087825) calcitonin receptor
cow(613317) calcitonin receptor
Horse(100061915) calcitonin receptor
dog(482306) calcitonin receptor
chicken(428425) calcitonin receptor
domestic guinea pig(100135491) calcitonin receptor
naked mole-rat(101719329) calcitonin receptor
sheep(101113579) calcitonin receptor
Domestic Rabbit(100009231) calcitonin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU063971 MISSION® esiRNA esiRNA human CALCR (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001742 Rosetta Predictions human pricing
NM_001034015 Rosetta Predictions rat pricing
NM_053816 Rosetta Predictions rat pricing
NM_001042725 Rosetta Predictions mouse pricing
NM_007588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077738 predicted 739
2 SASI_Hs01_00077739 predicted 907
3 SASI_Hs01_00077740 predicted 324
4 SASI_Hs01_00077741 predicted 352
5 SASI_Hs01_00077742 predicted 1659
6 SASI_Hs01_00077743 predicted 280
7 SASI_Hs01_00077745 predicted 437
8 SASI_Hs01_00077746 predicted 1585
9 SASI_Hs02_00332459 predicted 432
10 SASI_Hs02_00332460 predicted 1196
11 SASI_Hs01_00077744 predicted 449
12 SASI_Hs01_00077747 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110783 predicted 671
2 SASI_Rn01_00110784 predicted 450
3 SASI_Rn01_00110786 predicted 710
4 SASI_Rn01_00110787 predicted 576
5 SASI_Rn02_00203895 predicted 671
6 SASI_Rn01_00110788 predicted 1456
7 SASI_Rn01_00110789 predicted 1382
8 SASI_Rn01_00110790 predicted 1417
9 SASI_Rn02_00203896 predicted 1441
10 SASI_Rn01_00110792 predicted 1264
11 SASI_Rn01_00110785 predicted 1801
12 SASI_Rn01_00110791 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089802 predicted 676
2 SASI_Rn01_00089803 predicted 454
3 SASI_Rn01_00089805 predicted 717
4 SASI_Rn01_00089806 predicted 572
5 SASI_Rn02_00266641 predicted 669
6 SASI_Rn01_00089807 predicted 1568
7 SASI_Rn01_00089808 predicted 1485
8 SASI_Rn01_00089809 predicted 1528
9 SASI_Rn02_00266642 predicted 1544
10 SASI_Rn01_00089811 predicted 1377
11 SASI_Rn01_00089804 predicted 1913
12 SASI_Rn01_00089810 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291055 predicted 1898
2 SASI_Mm02_00291056 predicted 510
3 SASI_Mm02_00291057 predicted 627
4 SASI_Mm02_00291058 predicted 738
5 SASI_Mm02_00291059 predicted 2089
6 SASI_Mm02_00291060 predicted 1506
7 SASI_Mm02_00291061 predicted 329
8 SASI_Mm02_00291062 predicted 2015
9 SASI_Mm02_00291063 predicted 1941
10 SASI_Mm02_00291064 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311983 predicted 2266
2 SASI_Mm02_00311984 predicted 766
3 SASI_Mm01_00037423 predicted 871
4 SASI_Mm02_00311985 predicted 990
5 SASI_Mm02_00311986 predicted 2443
6 SASI_Mm01_00037424 predicted 1865
7 SASI_Mm02_00311987 predicted 576
8 SASI_Mm02_00311988 predicted 2380
9 SASI_Mm02_00311989 predicted 2301
10 SASI_Mm02_00311990 predicted 1803
11 SASI_Mm01_00037425 predicted 1495
12 SASI_Mm01_00037426 predicted 1439
13 SASI_Mm01_00037427 predicted 1689
14 SASI_Mm01_00037428 predicted 1177
15 SASI_Mm01_00037429 predicted 1067
16 SASI_Mm01_00037430 predicted 664
17 SASI_Mm01_00037431 predicted 1355
18 SASI_Mm01_00037432 predicted 964
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001742
CALCR MISSION shRNA Bacterial Glycerol Stock
calcitonin receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-854s1c1
Sequence:CCGGCCAACCACTATCCATGCTATTCTCGAGAATAGCATGGATAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-309s1c1
Sequence:CCGGCCTATCAGTTCTGCCCAGATTCTCGAGAATCTGGGCAGAACTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-163s1c1
Sequence:CCGGCGTAGGACGAAAGAAGATGATCTCGAGATCATCTTCTTTCGTCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-1427s1c1
Sequence:CCGGCCTTTGAATATCATAGAGCAACTCGAGTTGCTCTATGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-1094s21c1
Sequence:CCGGGGCGGCACTTGTGGTCAATTTCTCGAGAAATTGACCACAAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-451s21c1
Sequence:CCGGATCAGTTCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-945s21c1
Sequence:CCGGCAACGCTTGCGGTGGTATTATCTCGAGATAATACCACCGCAAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-550s21c1
Sequence:CCGGATCGAACCTGGTCCAACTATACTCGAGTATAGTTGGACCAGGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001742
CALCR MISSION shRNA shRNA Plasmid DNA
calcitonin receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-854s1c1
Sequence:CCGGCCAACCACTATCCATGCTATTCTCGAGAATAGCATGGATAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-309s1c1
Sequence:CCGGCCTATCAGTTCTGCCCAGATTCTCGAGAATCTGGGCAGAACTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-163s1c1
Sequence:CCGGCGTAGGACGAAAGAAGATGATCTCGAGATCATCTTCTTTCGTCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-1427s1c1
Sequence:CCGGCCTTTGAATATCATAGAGCAACTCGAGTTGCTCTATGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-1094s21c1
Sequence:CCGGGGCGGCACTTGTGGTCAATTTCTCGAGAAATTGACCACAAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-451s21c1
Sequence:CCGGATCAGTTCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-945s21c1
Sequence:CCGGCAACGCTTGCGGTGGTATTATCTCGAGATAATACCACCGCAAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-550s21c1
Sequence:CCGGATCGAACCTGGTCCAACTATACTCGAGTATAGTTGGACCAGGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001742
CALCR MISSION shRNA Lentiviral Transduction Particles
calcitonin receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-854s1c1
Sequence:CCGGCCAACCACTATCCATGCTATTCTCGAGAATAGCATGGATAGTGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-309s1c1
Sequence:CCGGCCTATCAGTTCTGCCCAGATTCTCGAGAATCTGGGCAGAACTGATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-163s1c1
Sequence:CCGGCGTAGGACGAAAGAAGATGATCTCGAGATCATCTTCTTTCGTCCTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001742.1-1427s1c1
Sequence:CCGGCCTTTGAATATCATAGAGCAACTCGAGTTGCTCTATGATATTCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-1094s21c1
Sequence:CCGGGGCGGCACTTGTGGTCAATTTCTCGAGAAATTGACCACAAGTGCCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-451s21c1
Sequence:CCGGATCAGTTCTGCCCAGATTATTCTCGAGAATAATCTGGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-945s21c1
Sequence:CCGGCAACGCTTGCGGTGGTATTATCTCGAGATAATACCACCGCAAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001742.2-550s21c1
Sequence:CCGGATCGAACCTGGTCCAACTATACTCGAGTATAGTTGGACCAGGTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007588
CALCR MISSION shRNA Bacterial Glycerol Stock
calcitonin receptor
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1752s1c1
Sequence:CCGGTCTGATTCATTTCCAGGGATTCTCGAGAATCCCTGGAAATGAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1975s1c1
Sequence:CCGGCCTCCAATCAGCAACAACGAACTCGAGTTCGTTGTTGCTGATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-946s1c1
Sequence:CCGGGTTCTTTATTACCTGGCTCTTCTCGAGAAGAGCCAGGTAATAAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1504s1c1
Sequence:CCGGCACTTGCTTTACATCATCCATCTCGAGATGGATGATGTAAAGCAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007588
CALCR MISSION shRNA shRNA Plasmid DNA
calcitonin receptor
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1752s1c1
Sequence:CCGGTCTGATTCATTTCCAGGGATTCTCGAGAATCCCTGGAAATGAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1975s1c1
Sequence:CCGGCCTCCAATCAGCAACAACGAACTCGAGTTCGTTGTTGCTGATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-946s1c1
Sequence:CCGGGTTCTTTATTACCTGGCTCTTCTCGAGAAGAGCCAGGTAATAAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1504s1c1
Sequence:CCGGCACTTGCTTTACATCATCCATCTCGAGATGGATGATGTAAAGCAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007588
CALCR MISSION shRNA Lentiviral Transduction Particles
calcitonin receptor
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1752s1c1
Sequence:CCGGTCTGATTCATTTCCAGGGATTCTCGAGAATCCCTGGAAATGAATCAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1975s1c1
Sequence:CCGGCCTCCAATCAGCAACAACGAACTCGAGTTCGTTGTTGCTGATTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-946s1c1
Sequence:CCGGGTTCTTTATTACCTGGCTCTTCTCGAGAAGAGCCAGGTAATAAAGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007588.1-1504s1c1
Sequence:CCGGCACTTGCTTTACATCATCCATCTCGAGATGGATGATGTAAAGCAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks