EMAIL THIS PAGE TO A FRIEND

CALCRL

calcitonin receptor-like

96 Gene Product Result for
Synonyms: CGRPR CRLR
UniProtKB ID: Q16602, A8K6G5, A8KAD3, Q53S02, Q53TS5
Gene ID:
Mouse(54598) calcitonin receptor-like
Rat(25029) calcitonin receptor-like
Goat(100861156) calcitonin receptor-like
sheep(101115511) calcitonin receptor-like
naked mole-rat(101711427) calcitonin receptor-like
domestic guinea pig(100727450) calcitonin receptor-like
chicken(423990) calcitonin receptor-like
domestic cat(101086333) calcitonin receptor-like
cow(527140) calcitonin receptor-like
Horse(100054281) calcitonin receptor-like
dog(488438) calcitonin receptor-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
I6891 H-7 human, rat pricing
M9656 H-8 dihydrochloride >98% (HPLC) human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005795 Rosetta Predictions human pricing
NM_012717 Rosetta Predictions rat pricing
NM_018782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049714 predicted 1178
2 SASI_Hs01_00049715 predicted 1840
3 SASI_Hs01_00049716 predicted 1802
4 SASI_Hs01_00049717 predicted 1384
5 SASI_Hs01_00049718 predicted 1335
6 SASI_Hs01_00049719 predicted 940
7 SASI_Hs01_00049720 predicted 1388
8 SASI_Hs01_00049722 predicted 1008
9 SASI_Hs01_00049723 predicted 1404
10 SASI_Hs02_00340294 predicted 1113
11 SASI_Hs01_00049721 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088399 predicted 1848
2 SASI_Rn01_00088401 predicted 1300
3 SASI_Rn01_00088402 predicted 868
4 SASI_Rn01_00088403 predicted 818
5 SASI_Rn01_00088404 predicted 1587
6 SASI_Rn02_00260054 predicted 473
7 SASI_Rn02_00260055 predicted 1565
8 SASI_Rn01_00088406 predicted 1429
9 SASI_Rn01_00088407 predicted 830
10 SASI_Rn01_00088408 predicted 1861
11 SASI_Rn01_00088400 predicted 673
12 SASI_Rn01_00088405 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198953 predicted 602
2 SASI_Mm01_00198954 predicted 1005
3 SASI_Mm01_00198955 predicted 739
4 SASI_Mm01_00198956 predicted 1373
5 SASI_Mm01_00198957 predicted 1162
6 SASI_Mm01_00198958 predicted 1627
7 SASI_Mm01_00198959 predicted 1209
8 SASI_Mm01_00198960 predicted 441
9 SASI_Mm01_00198962 predicted 1279
10 SASI_Mm02_00324092 predicted 517
11 SASI_Mm01_00198961 predicted 1364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005795
CALCRL MISSION shRNA Bacterial Glycerol Stock
calcitonin receptor-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1017s21c1
Sequence:CCGGCTTATCTCGCTTGGCATATTCCTCGAGGAATATGCCAAGCGAGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1208s21c1
Sequence:CCGGTTACCTGATGGGCTGTAATTACTCGAGTAATTACAGCCCATCAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1360s21c1
Sequence:CCGGCCATTGCTAGAAGCTTATATTCTCGAGAATATAAGCTTCTAGCAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005795.4-2306s21c1
Sequence:CCGGGGGCATGATTCTACCCTTATTCTCGAGAATAAGGGTAGAATCATGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-635s1c1
Sequence:CCGGGCTCAATATGAATGTTACCAACTCGAGTTGGTAACATTCATATTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-769s1c1
Sequence:CCGGCCCTGATTACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTAATCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1403s1c1
Sequence:CCGGGCTGCTTTACTGGTGAATCTTCTCGAGAAGATTCACCAGTAAAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005795.2-2704s1c1
Sequence:CCGGCCTTCCATTTCTACTGTATAACTCGAGTTATACAGTAGAAATGGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1447s1c1
Sequence:CCGGCGTTCTCATCACCAAGTTAAACTCGAGTTTAACTTGGTGATGAGAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005795
CALCRL MISSION shRNA shRNA Plasmid DNA
calcitonin receptor-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1017s21c1
Sequence:CCGGCTTATCTCGCTTGGCATATTCCTCGAGGAATATGCCAAGCGAGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1208s21c1
Sequence:CCGGTTACCTGATGGGCTGTAATTACTCGAGTAATTACAGCCCATCAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1360s21c1
Sequence:CCGGCCATTGCTAGAAGCTTATATTCTCGAGAATATAAGCTTCTAGCAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005795.4-2306s21c1
Sequence:CCGGGGGCATGATTCTACCCTTATTCTCGAGAATAAGGGTAGAATCATGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-635s1c1
Sequence:CCGGGCTCAATATGAATGTTACCAACTCGAGTTGGTAACATTCATATTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-769s1c1
Sequence:CCGGCCCTGATTACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTAATCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1403s1c1
Sequence:CCGGGCTGCTTTACTGGTGAATCTTCTCGAGAAGATTCACCAGTAAAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005795.2-2704s1c1
Sequence:CCGGCCTTCCATTTCTACTGTATAACTCGAGTTATACAGTAGAAATGGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1447s1c1
Sequence:CCGGCGTTCTCATCACCAAGTTAAACTCGAGTTTAACTTGGTGATGAGAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005795
CALCRL MISSION shRNA Lentiviral Transduction Particles
calcitonin receptor-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1017s21c1
Sequence:CCGGCTTATCTCGCTTGGCATATTCCTCGAGGAATATGCCAAGCGAGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1208s21c1
Sequence:CCGGTTACCTGATGGGCTGTAATTACTCGAGTAATTACAGCCCATCAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005795.4-1360s21c1
Sequence:CCGGCCATTGCTAGAAGCTTATATTCTCGAGAATATAAGCTTCTAGCAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356734    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005795.4-2306s21c1
Sequence:CCGGGGGCATGATTCTACCCTTATTCTCGAGAATAAGGGTAGAATCATGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-635s1c1
Sequence:CCGGGCTCAATATGAATGTTACCAACTCGAGTTGGTAACATTCATATTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-769s1c1
Sequence:CCGGCCCTGATTACTTTCAGGACTTCTCGAGAAGTCCTGAAAGTAATCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1403s1c1
Sequence:CCGGGCTGCTTTACTGGTGAATCTTCTCGAGAAGATTCACCAGTAAAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008166    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005795.2-2704s1c1
Sequence:CCGGCCTTCCATTTCTACTGTATAACTCGAGTTATACAGTAGAAATGGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005795.2-1447s1c1
Sequence:CCGGCGTTCTCATCACCAAGTTAAACTCGAGTTTAACTTGGTGATGAGAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018782
VALIDATED
CALCRL MISSION shRNA Bacterial Glycerol Stock
calcitonin receptor-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-926s21c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018782.2-2001s21c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1338s21c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1027s21c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-233s1c1
Sequence:CCGGGCCTCTTAATATGGCTCTCATCTCGAGATGAGAGCCATATTAAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1678s1c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-704s1c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1015s1c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-603s1c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018782
VALIDATED
CALCRL MISSION shRNA shRNA Plasmid DNA
calcitonin receptor-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-926s21c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018782.2-2001s21c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1338s21c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1027s21c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-233s1c1
Sequence:CCGGGCCTCTTAATATGGCTCTCATCTCGAGATGAGAGCCATATTAAGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1678s1c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-704s1c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1015s1c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-603s1c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018782
VALIDATED
CALCRL MISSION shRNA Lentiviral Transduction Particles
calcitonin receptor-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-926s21c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319851    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018782.2-2001s21c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1338s21c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018782.2-1027s21c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-233s1c1
Sequence:CCGGGCCTCTTAATATGGCTCTCATCTCGAGATGAGAGCCATATTAAGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1678s1c1
Sequence:CCGGCCCTCAAATGAAATGGGAATTCTCGAGAATTCCCATTTCATTTGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-704s1c1
Sequence:CCGGCCAACGGATCACATTGCATAACTCGAGTTATGCAATGTGATCCGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-1015s1c1
Sequence:CCGGGCTTGTATTACAACGACAATTCTCGAGAATTGTCGTTGTAATACAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018782.1-603s1c1
Sequence:CCGGGCCCTGAATCTGTTCTACCTACTCGAGTAGGTAGAACAGATTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)