EMAIL THIS PAGE TO A FRIEND

CALD1

caldesmon 1

Synonyms: CDM H-CAD HCAD L-CAD LCAD NAG22
Gene ID:
Human(800) Summary: This gene encodes a calmodulin- and actin-binding protein that plays an essential role in the regulation of smooth muscle and nonmuscle contraction. The conserved domain of this protein possesses the binding activities to Ca(2+)-calmodulin, actin, tropomyosin, myosin, and phospholipids. This protein is a potent inhibitor of the actin-tropomyosin activated myosin MgATPase, and serves as a mediating factor for Ca(2+)-dependent inhibition of smooth muscle contraction. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Mouse(109624) caldesmon 1
Rat(25687) caldesmon 1
Zebrafish(563892) caldesmon 1
cow(281660) caldesmon 1
chicken(373965) caldesmon 1
sheep(101121342) caldesmon 1
Gene Class: Cytoskeleton
296 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405549 Anti-CALD1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
HPA008066 Anti-CALD1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV42684 Anti-CALD1 antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, rabbit, mouse, horse, bovine, human, rat, rabbit
western blot pricing
HPA017330 Anti-CALD1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2103323 Anti-CALD1 antibody produced in rabbit affinity isolated antibody bovine, rabbit, rabbit, rat, guinea pig, human, pig, mouse, horse
western blot pricing
SAB4503188 Anti-Caldesmon, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
pricing
SAB4503189 Anti-Caldesmon, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
pricing
SAB5500025 Anti-Caldesmon-Pan antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP226, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4503901 Anti-phospho-Caldesmon (pSer789) antibody produced in rabbit affinity isolated antibody rat, human, mouse
pricing
SAB4301508 Anti-phospho-Caldesmon (pSer789) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
C4562 Monoclonal Anti-Caldesmon (Smooth) antibody produced in mouse clone hHCD, ascites fluid bovine, sheep, mouse, rabbit, pig, human
immunohistochemistry, immunoprecipitation, western blot pricing
C6542 Monoclonal Anti-Caldesmon antibody produced in mouse clone CALD-5, ascites fluid chicken, human
immunofluorescence, microarray, western blot pricing
C6292 Monoclonal Anti-Caldesmon antibody produced in mouse clone CALD-8, ascites fluid human, pig, rabbit, guinea pig
immunofluorescence, western blot pricing
C0297 Monoclonal Anti-Caldesmon antibody produced in mouse clone C21, ascites fluid mammals
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004342 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004342 Rosetta Predictions human pricing
NM_033138 Rosetta Predictions human pricing
NM_033139 Rosetta Predictions human pricing
NM_033140 Rosetta Predictions human pricing
NM_033157 Rosetta Predictions human pricing
NM_013146 Rosetta Predictions rat pricing
NM_145575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101215 predicted 1803
2 SASI_Hs01_00101216 predicted 2147
3 SASI_Hs01_00101217 predicted 1924
4 SASI_Hs01_00101218 predicted 1957
5 SASI_Hs01_00101219 predicted 2116
6 SASI_Hs01_00101220 predicted 1733
7 SASI_Hs01_00101221 predicted 2201
8 SASI_Hs02_00337400 predicted 2122
9 SASI_Hs01_00101222 predicted 2198
10 SASI_Hs02_00337401 predicted 2029
11 SASI_Hs01_00101223 predicted 1740
12 SASI_Hs01_00101224 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103337 predicted 2572
2 SASI_Hs01_00103339 predicted 2684
3 SASI_Hs01_00103340 predicted 2721
4 SASI_Hs01_00103341 predicted 2878
5 SASI_Hs01_00103342 predicted 2494
6 SASI_Hs01_00103343 predicted 2966
7 SASI_Hs02_00360869 predicted 2889
8 SASI_Hs01_00103344 predicted 2959
9 SASI_Hs02_00360870 predicted 2798
10 SASI_Hs02_00360871 predicted 2971
11 SASI_Hs01_00103338 predicted 2911
12 SASI_Hs01_00103345 predicted 2505
13 SASI_Hs01_00103346 predicted 2747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130616 predicted 1620
2 SASI_Hs01_00130617 predicted 1959
3 SASI_Hs01_00130618 predicted 1737
4 SASI_Hs01_00130619 predicted 1774
5 SASI_Hs01_00130620 predicted 1931
6 SASI_Hs01_00130621 predicted 1541
7 SASI_Hs01_00130622 predicted 2024
8 SASI_Hs02_00360872 predicted 1942
9 SASI_Hs01_00130623 predicted 2010
10 SASI_Hs02_00360873 predicted 1851
11 SASI_Hs01_00130624 predicted 1555
12 SASI_Hs01_00130625 predicted 1793
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246731 predicted 1538
2 SASI_Hs01_00246733 predicted 1658
3 SASI_Hs01_00246734 predicted 1699
4 SASI_Hs01_00246735 predicted 1844
5 SASI_Hs01_00246736 predicted 1460
6 SASI_Hs01_00246737 predicted 1945
7 SASI_Hs02_00360874 predicted 1858
8 SASI_Hs01_00246738 predicted 1935
9 SASI_Hs02_00360875 predicted 1770
10 SASI_Hs02_00360876 predicted 1941
11 SASI_Hs01_00246732 predicted 1890
12 SASI_Hs01_00246739 predicted 1484
13 SASI_Hs01_00246740 predicted 1711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033157 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034389 predicted 1884
2 SASI_Hs01_00034390 predicted 2222
3 SASI_Hs01_00034391 predicted 2004
4 SASI_Hs01_00034392 predicted 2034
5 SASI_Hs01_00034393 predicted 2192
6 SASI_Hs01_00034394 predicted 1808
7 SASI_Hs01_00034395 predicted 2285
8 SASI_Hs02_00360891 predicted 2204
9 SASI_Hs01_00034396 predicted 2277
10 SASI_Hs02_00360892 predicted 2107
11 SASI_Hs01_00034397 predicted 1825
12 SASI_Hs01_00034398 predicted 2051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108316 predicted 1962
2 SASI_Rn01_00108318 predicted 1998
3 SASI_Rn01_00108319 predicted 1808
4 SASI_Rn01_00108320 predicted 218
5 SASI_Rn01_00108321 predicted 1613
6 SASI_Rn01_00108322 predicted 1808
7 SASI_Rn01_00108323 predicted 1858
8 SASI_Rn02_00260945 predicted 1960
9 SASI_Rn02_00260946 predicted 1834
10 SASI_Rn02_00260947 predicted 1774
11 SASI_Rn01_00108317 predicted 1848
12 SASI_Rn01_00108324 predicted 411
13 SASI_Rn01_00108325 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341096 predicted 533
2 SASI_Mm01_00084235 predicted 265
3 SASI_Mm02_00341097 predicted 530
4 SASI_Mm02_00341098 predicted 684
5 SASI_Mm01_00084237 predicted 1853
6 SASI_Mm01_00084238 predicted 1847
7 SASI_Mm01_00084240 predicted 1883
8 SASI_Mm01_00084241 predicted 1660
9 SASI_Mm02_00341099 predicted 1394
10 SASI_Mm01_00084243 predicted 1755
11 SASI_Mm01_00084236 predicted 1896
12 SASI_Mm01_00084239 predicted 2022
13 SASI_Mm01_00084242 predicted 1867
14 SASI_Mm01_00084244 predicted 1596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004342
VALIDATED
CALD1 MISSION shRNA Bacterial Glycerol Stock
caldesmon 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1137s1c1
Sequence:CCGGCATGGATCGAAAGAAGGGATTCTCGAGAATCCCTTCTTTCGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004342.5-1339s1c1
Sequence:CCGGGAAGAGTTCGAGAAGCTCAAACTCGAGTTTGAGCTTCTCGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-925s1c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-519s1c1
Sequence:CCGGCGAAGCAGAAAGAATCGCCTACTCGAGTAGGCGATTCTTTCTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1561s1c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004342.5-1925s1c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-925s21c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004342.5-1925s21c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-1561s21c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004342.5-2118s21c1
Sequence:CCGGCTCAGTTGTAGAGGGCTAATTCTCGAGAATTAGCCCTCTACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004342
VALIDATED
CALD1 MISSION shRNA shRNA Plasmid DNA
caldesmon 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1137s1c1
Sequence:CCGGCATGGATCGAAAGAAGGGATTCTCGAGAATCCCTTCTTTCGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004342.5-1339s1c1
Sequence:CCGGGAAGAGTTCGAGAAGCTCAAACTCGAGTTTGAGCTTCTCGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-925s1c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-519s1c1
Sequence:CCGGCGAAGCAGAAAGAATCGCCTACTCGAGTAGGCGATTCTTTCTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1561s1c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004342.5-1925s1c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-925s21c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004342.5-1925s21c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-1561s21c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004342.5-2118s21c1
Sequence:CCGGCTCAGTTGTAGAGGGCTAATTCTCGAGAATTAGCCCTCTACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004342
VALIDATED
CALD1 MISSION shRNA Lentiviral Transduction Particles
caldesmon 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1137s1c1
Sequence:CCGGCATGGATCGAAAGAAGGGATTCTCGAGAATCCCTTCTTTCGATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004342.5-1339s1c1
Sequence:CCGGGAAGAGTTCGAGAAGCTCAAACTCGAGTTTGAGCTTCTCGAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-925s1c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-519s1c1
Sequence:CCGGCGAAGCAGAAAGAATCGCCTACTCGAGTAGGCGATTCTTTCTGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004342.5-1561s1c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004342.5-1925s1c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-925s21c1
Sequence:CCGGCGCCAAGAAAGATACGAGATACTCGAGTATCTCGTATCTTTCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_004342.5-1925s21c1
Sequence:CCGGGCCGCATCAATGAATGGCTAACTCGAGTTAGCCATTCATTGATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004342.5-1561s21c1
Sequence:CCGGCCAGAAGATGGCTTGTCAGATCTCGAGATCTGACAAGCCATCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330609    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004342.5-2118s21c1
Sequence:CCGGCTCAGTTGTAGAGGGCTAATTCTCGAGAATTAGCCCTCTACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145575
VALIDATED
CALD1 MISSION shRNA Bacterial Glycerol Stock
caldesmon 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145575.1-1934s1c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1376s1c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1602s1c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-826s1c1
Sequence:CCGGGAAAGGATTTACAGAAGTGAACTCGAGTTCACTTCTGTAAATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1495s1c1
Sequence:CCGGCGTCCGCAATATCAAGAGCATCTCGAGATGCTCTTGATATTGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-539s21c1
Sequence:CCGGAGGAGTTTGATCCGACCATAACTCGAGTTATGGTCGGATCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145575.3-1417s21c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1643s21c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1975s21c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1209s21c1
Sequence:CCGGGGAAGAGAAGAGGAGGTTAAACTCGAGTTTAACCTCCTCTTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145575
VALIDATED
CALD1 MISSION shRNA shRNA Plasmid DNA
caldesmon 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145575.1-1934s1c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1376s1c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1602s1c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-826s1c1
Sequence:CCGGGAAAGGATTTACAGAAGTGAACTCGAGTTCACTTCTGTAAATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1495s1c1
Sequence:CCGGCGTCCGCAATATCAAGAGCATCTCGAGATGCTCTTGATATTGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-539s21c1
Sequence:CCGGAGGAGTTTGATCCGACCATAACTCGAGTTATGGTCGGATCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145575.3-1417s21c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1643s21c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1975s21c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1209s21c1
Sequence:CCGGGGAAGAGAAGAGGAGGTTAAACTCGAGTTTAACCTCCTCTTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145575
VALIDATED
CALD1 MISSION shRNA Lentiviral Transduction Particles
caldesmon 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108680    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145575.1-1934s1c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1376s1c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1602s1c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-826s1c1
Sequence:CCGGGAAAGGATTTACAGAAGTGAACTCGAGTTCACTTCTGTAAATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145575.1-1495s1c1
Sequence:CCGGCGTCCGCAATATCAAGAGCATCTCGAGATGCTCTTGATATTGCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-539s21c1
Sequence:CCGGAGGAGTTTGATCCGACCATAACTCGAGTTATGGTCGGATCAAACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145575.3-1417s21c1
Sequence:CCGGGCAGCAGTAGTCTCCAAGATTCTCGAGAATCTTGGAGACTACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1643s21c1
Sequence:CCGGGCCGCATTAACGAATGGCTAACTCGAGTTAGCCATTCGTTAATGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303123    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1975s21c1
Sequence:CCGGGCCTGTTTCTAAAGAAACCATCTCGAGATGGTTTCTTTAGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145575.3-1209s21c1
Sequence:CCGGGGAAGAGAAGAGGAGGTTAAACTCGAGTTTAACCTCCTCTTCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks