EMAIL THIS PAGE TO A FRIEND

CALHM1

calcium homeostasis modulator 1

Synonyms: FAM26C
UniProtKB ID: Q8IU99, Q5W091
Gene ID:
Human(255022) Summary: This gene encodes a calcium channel that plays a role in processing of amyloid-beta precursor protein. A polymorphism at this locus has been reported to be associated with susceptibility to late-onset Alzheimer's disease in some populations, but the pathogenicity of this polymorphism is unclear.[provided by RefSeq, Mar 2010]
Mouse(546729) calcium homeostasis modulator 1
Rat(499367) calcium homeostasis modulator 1
Zebrafish(100005176) calcium homeostasis modulator 1
domestic cat(101087353) calcium homeostasis modulator 1
cow(532026) calcium homeostasis modulator 1
Horse(100069751) calcium homeostasis modulator 1
dog(486871) calcium homeostasis modulator 1
chicken(428977) calcium homeostasis modulator 1
sheep(101112364) calcium homeostasis modulator 1
naked mole-rat(101705631) calcium homeostasis modulator 1
domestic guinea pig(100722745) calcium homeostasis modulator 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081271 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081271 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081271 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001412 Rosetta Predictions human pricing
NM_001109168 Rosetta Predictions rat pricing
NM_001081271 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122688 predicted 1394
2 SASI_Hs01_00122689 predicted 781
3 SASI_Hs01_00122690 predicted 987
4 SASI_Hs01_00122691 predicted 1256
5 SASI_Hs01_00122692 predicted 1552
6 SASI_Hs01_00122693 predicted 721
7 SASI_Hs01_00122694 predicted 1017
8 SASI_Hs02_00303735 predicted 1378
9 SASI_Hs01_00122695 predicted 1353
10 SASI_Hs01_00122696 predicted 1138
11 SASI_Hs01_00122697 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245790 predicted 676
2 SASI_Rn02_00245791 predicted 213
3 SASI_Rn02_00245792 predicted 780
4 SASI_Rn02_00245793 predicted 645
5 SASI_Rn02_00245794 predicted 620
6 SASI_Rn02_00245795 predicted 767
7 SASI_Rn02_00245796 predicted 697
8 SASI_Rn02_00245797 predicted 705
9 SASI_Rn02_00245798 predicted 281
10 SASI_Rn02_00245799 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081271 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296837 predicted 770
2 SASI_Mm02_00296838 predicted 644
3 SASI_Mm02_00296839 predicted 522
4 SASI_Mm02_00296840 predicted 273
5 SASI_Mm02_00296841 predicted 715
6 SASI_Mm02_00296842 predicted 692
7 SASI_Mm02_00296843 predicted 278
8 SASI_Mm02_00296844 predicted 259
9 SASI_Mm02_00296845 predicted 481
10 SASI_Mm02_00296846 predicted 705
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081271
CALHM1 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-83s21c1
Sequence:CCGGTGGCCAGTGCGCAGATGTATTCTCGAGAATACATCTGCGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-731s21c1
Sequence:CCGGTATGTATCCAGCAGTTCTTTGCTCGAGCAAAGAACTGCTGGATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-41s21c1
Sequence:CCGGACCAAGAGTCCTTCATGAATGCTCGAGCATTCATGAAGGACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-473s21c1
Sequence:CCGGTACCCTGCCCTGAGATCTATGCTCGAGCATAGATCTCAGGGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-569s21c1
Sequence:CCGGTCGTGCTGCTGACCACATTACCTCGAGGTAATGTGGTCAGCAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081271
CALHM1 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-83s21c1
Sequence:CCGGTGGCCAGTGCGCAGATGTATTCTCGAGAATACATCTGCGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-731s21c1
Sequence:CCGGTATGTATCCAGCAGTTCTTTGCTCGAGCAAAGAACTGCTGGATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-41s21c1
Sequence:CCGGACCAAGAGTCCTTCATGAATGCTCGAGCATTCATGAAGGACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-473s21c1
Sequence:CCGGTACCCTGCCCTGAGATCTATGCTCGAGCATAGATCTCAGGGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-569s21c1
Sequence:CCGGTCGTGCTGCTGACCACATTACCTCGAGGTAATGTGGTCAGCAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081271
CALHM1 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-83s21c1
Sequence:CCGGTGGCCAGTGCGCAGATGTATTCTCGAGAATACATCTGCGCACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-731s21c1
Sequence:CCGGTATGTATCCAGCAGTTCTTTGCTCGAGCAAAGAACTGCTGGATACATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-41s21c1
Sequence:CCGGACCAAGAGTCCTTCATGAATGCTCGAGCATTCATGAAGGACTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-473s21c1
Sequence:CCGGTACCCTGCCCTGAGATCTATGCTCGAGCATAGATCTCAGGGCAGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081271.1-569s21c1
Sequence:CCGGTCGTGCTGCTGACCACATTACCTCGAGGTAATGTGGTCAGCAGCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001412
CALHM1 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-347s1c1
Sequence:CCGGCATGAACAACAACGTGTCCATCTCGAGATGGACACGTTGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-197s1c1
Sequence:CCGGGAATGGCATCTGTGGCATCATCTCGAGATGATGCCACAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-1820s1c1
Sequence:CCGGCCAGGTGGACTGCATGTTTATCTCGAGATAAACATGCAGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-341s1c1
Sequence:CCGGCCTGGTCATGAACAACAACGTCTCGAGACGTTGTTGTTCATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-2188s1c1
Sequence:CCGGGCCTTCGTTTCTTCATCTATACTCGAGTATAGATGAAGAAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001412
CALHM1 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-347s1c1
Sequence:CCGGCATGAACAACAACGTGTCCATCTCGAGATGGACACGTTGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-197s1c1
Sequence:CCGGGAATGGCATCTGTGGCATCATCTCGAGATGATGCCACAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-1820s1c1
Sequence:CCGGCCAGGTGGACTGCATGTTTATCTCGAGATAAACATGCAGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-341s1c1
Sequence:CCGGCCTGGTCATGAACAACAACGTCTCGAGACGTTGTTGTTCATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-2188s1c1
Sequence:CCGGGCCTTCGTTTCTTCATCTATACTCGAGTATAGATGAAGAAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001412
CALHM1 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-347s1c1
Sequence:CCGGCATGAACAACAACGTGTCCATCTCGAGATGGACACGTTGTTGTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-197s1c1
Sequence:CCGGGAATGGCATCTGTGGCATCATCTCGAGATGATGCCACAGATGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-1820s1c1
Sequence:CCGGCCAGGTGGACTGCATGTTTATCTCGAGATAAACATGCAGTCCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001412.1-341s1c1
Sequence:CCGGCCTGGTCATGAACAACAACGTCTCGAGACGTTGTTGTTCATGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001412.1-2188s1c1
Sequence:CCGGGCCTTCGTTTCTTCATCTATACTCGAGTATAGATGAAGAAACGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks