EMAIL THIS PAGE TO A FRIEND

CALHM2

calcium homeostasis modulator 2

Synonyms: FAM26B
UniProtKB ID: Q9HA72, D3DR94, O95893, Q6ZUV9
Gene ID:
Mouse(72691) calcium homeostasis modulator 2
Rat(294019) calcium homeostasis modulator 2
domestic guinea pig(100721728) calcium homeostasis modulator 2
naked mole-rat(101704189) calcium homeostasis modulator 2
sheep(101112099) calcium homeostasis modulator 2
Zebrafish(368657) calcium homeostasis modulator 2
cow(537067) calcium homeostasis modulator 2
domestic cat(101088113) calcium homeostasis modulator 2
dog(486870) calcium homeostasis modulator 2
chicken(770753) calcium homeostasis modulator 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014706 Anti-CALHM2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015916 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015916 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015916 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015916 Rosetta Predictions human pricing
NM_001008306 Rosetta Predictions rat pricing
NM_133746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057607 predicted 901
2 SASI_Hs01_00057608 predicted 1060
3 SASI_Hs01_00057609 predicted 1524
4 SASI_Hs01_00057610 predicted 1252
5 SASI_Hs02_00348531 predicted 755
6 SASI_Hs01_00057611 predicted 1013
7 SASI_Hs01_00057612 predicted 1369
8 SASI_Hs01_00057613 predicted 1122
9 SASI_Hs01_00057615 predicted 1183
10 SASI_Hs01_00057616 predicted 1134
11 SASI_Hs01_00057614 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098808 predicted 811
2 SASI_Rn01_00098809 predicted 1244
3 SASI_Rn01_00098810 predicted 907
4 SASI_Rn01_00098811 predicted 413
5 SASI_Rn01_00098812 predicted 1594
6 SASI_Rn01_00098813 predicted 706
7 SASI_Rn01_00098814 predicted 1365
8 SASI_Rn01_00098815 predicted 598
9 SASI_Rn01_00098817 predicted 1545
10 SASI_Rn02_00199026 predicted 1366
11 SASI_Rn01_00098816 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191173 predicted 1279
2 SASI_Mm01_00191174 predicted 1428
3 SASI_Mm01_00191175 predicted 1541
4 SASI_Mm01_00191176 predicted 711
5 SASI_Mm01_00191177 predicted 1213
6 SASI_Mm01_00191178 predicted 703
7 SASI_Mm01_00191179 predicted 1396
8 SASI_Mm01_00191180 predicted 1541
9 SASI_Mm02_00338733 predicted 711
10 SASI_Mm01_00191181 predicted 1802
11 SASI_Mm01_00191172 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015916
CALHM2 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1139s1c1
Sequence:CCGGCAAGCATTACTGCTCACCACTCTCGAGAGTGGTGAGCAGTAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1376s1c1
Sequence:CCGGCTACTTGTACCGTGAGAACCACTCGAGTGGTTCTCACGGTACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1290s1c1
Sequence:CCGGCTCAACAAGGATGATGAGGAACTCGAGTTCCTCATCATCCTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-725s1c1
Sequence:CCGGGCTCTTCATCATTGGCATCATCTCGAGATGATGCCAATGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-572s1c1
Sequence:CCGGCAAGAGCAAGGATGTGATGATCTCGAGATCATCACATCCTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-569s1c1
Sequence:CCGGCTTCAAGAGCAAGGATGTGATCTCGAGATCACATCCTTGCTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1289s1c1
Sequence:CCGGGCTCAACAAGGATGATGAGGACTCGAGTCCTCATCATCCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015916.4-952s21c1
Sequence:CCGGCTGTCACCTGGTCTGTCATCTCTCGAGAGATGACAGACCAGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1643s21c1
Sequence:CCGGGCTTGCTCACATCCATATCAGCTCGAGCTGATATGGATGTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1787s21c1
Sequence:CCGGCTCACCAGTGGGCTCCTTTATCTCGAGATAAAGGAGCCCACTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015916
CALHM2 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1139s1c1
Sequence:CCGGCAAGCATTACTGCTCACCACTCTCGAGAGTGGTGAGCAGTAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1376s1c1
Sequence:CCGGCTACTTGTACCGTGAGAACCACTCGAGTGGTTCTCACGGTACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1290s1c1
Sequence:CCGGCTCAACAAGGATGATGAGGAACTCGAGTTCCTCATCATCCTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-725s1c1
Sequence:CCGGGCTCTTCATCATTGGCATCATCTCGAGATGATGCCAATGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-572s1c1
Sequence:CCGGCAAGAGCAAGGATGTGATGATCTCGAGATCATCACATCCTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-569s1c1
Sequence:CCGGCTTCAAGAGCAAGGATGTGATCTCGAGATCACATCCTTGCTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1289s1c1
Sequence:CCGGGCTCAACAAGGATGATGAGGACTCGAGTCCTCATCATCCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015916.4-952s21c1
Sequence:CCGGCTGTCACCTGGTCTGTCATCTCTCGAGAGATGACAGACCAGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1643s21c1
Sequence:CCGGGCTTGCTCACATCCATATCAGCTCGAGCTGATATGGATGTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1787s21c1
Sequence:CCGGCTCACCAGTGGGCTCCTTTATCTCGAGATAAAGGAGCCCACTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015916
CALHM2 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1139s1c1
Sequence:CCGGCAAGCATTACTGCTCACCACTCTCGAGAGTGGTGAGCAGTAATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1376s1c1
Sequence:CCGGCTACTTGTACCGTGAGAACCACTCGAGTGGTTCTCACGGTACAAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162509    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1290s1c1
Sequence:CCGGCTCAACAAGGATGATGAGGAACTCGAGTTCCTCATCATCCTTGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-725s1c1
Sequence:CCGGGCTCTTCATCATTGGCATCATCTCGAGATGATGCCAATGATGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-572s1c1
Sequence:CCGGCAAGAGCAAGGATGTGATGATCTCGAGATCATCACATCCTTGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-569s1c1
Sequence:CCGGCTTCAAGAGCAAGGATGTGATCTCGAGATCACATCCTTGCTCTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015916.3-1289s1c1
Sequence:CCGGGCTCAACAAGGATGATGAGGACTCGAGTCCTCATCATCCTTGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015916.4-952s21c1
Sequence:CCGGCTGTCACCTGGTCTGTCATCTCTCGAGAGATGACAGACCAGGTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1643s21c1
Sequence:CCGGGCTTGCTCACATCCATATCAGCTCGAGCTGATATGGATGTGAGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015916.4-1787s21c1
Sequence:CCGGCTCACCAGTGGGCTCCTTTATCTCGAGATAAAGGAGCCCACTGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133746
VALIDATED
CALHM2 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-938s1c1
Sequence:CCGGGTCTGTGCTCTCAGTGAGTTTCTCGAGAAACTCACTGAGAGCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1528s1c1
Sequence:CCGGGCCTGCTTCTATGCTCTGTAACTCGAGTTACAGAGCATAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133746.2-1769s1c1
Sequence:CCGGGCTCACAGCTATCAGAAAGTACTCGAGTACTTTCTGATAGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-1154s1c1
Sequence:CCGGCTGACCAAGTGCCTCAAACATCTCGAGATGTTTGAGGCACTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-716s1c1
Sequence:CCGGCTGTATGGACTGACAGCAATTCTCGAGAATTGCTGTCAGTCCATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1891s1c1
Sequence:CCGGCCTTCATTGTATAGTACACTTCTCGAGAAGTGTACTATACAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133746
VALIDATED
CALHM2 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-938s1c1
Sequence:CCGGGTCTGTGCTCTCAGTGAGTTTCTCGAGAAACTCACTGAGAGCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1528s1c1
Sequence:CCGGGCCTGCTTCTATGCTCTGTAACTCGAGTTACAGAGCATAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133746.2-1769s1c1
Sequence:CCGGGCTCACAGCTATCAGAAAGTACTCGAGTACTTTCTGATAGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-1154s1c1
Sequence:CCGGCTGACCAAGTGCCTCAAACATCTCGAGATGTTTGAGGCACTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-716s1c1
Sequence:CCGGCTGTATGGACTGACAGCAATTCTCGAGAATTGCTGTCAGTCCATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1891s1c1
Sequence:CCGGCCTTCATTGTATAGTACACTTCTCGAGAAGTGTACTATACAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133746
VALIDATED
CALHM2 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-938s1c1
Sequence:CCGGGTCTGTGCTCTCAGTGAGTTTCTCGAGAAACTCACTGAGAGCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173893    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1528s1c1
Sequence:CCGGGCCTGCTTCTATGCTCTGTAACTCGAGTTACAGAGCATAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133746.2-1769s1c1
Sequence:CCGGGCTCACAGCTATCAGAAAGTACTCGAGTACTTTCTGATAGCTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-1154s1c1
Sequence:CCGGCTGACCAAGTGCCTCAAACATCTCGAGATGTTTGAGGCACTTGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133746.2-716s1c1
Sequence:CCGGCTGTATGGACTGACAGCAATTCTCGAGAATTGCTGTCAGTCCATACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133746.2-1891s1c1
Sequence:CCGGCCTTCATTGTATAGTACACTTCTCGAGAAGTGTACTATACAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks