EMAIL THIS PAGE TO A FRIEND

CALHM3

calcium homeostasis modulator 3

92 Gene Product Result for
Synonyms: FAM26A bA225H22.7
UniProtKB ID: Q86XJ0, Q5W090, Q8IXR2
Gene ID:
Mouse(240669) calcium homeostasis modulator 3
Rat(499368) calcium homeostasis modulator 3
Zebrafish(100005130) calcium homeostasis modulator 3
chicken(428978) calcium homeostasis modulator 3
domestic cat(101087611) calcium homeostasis modulator 3
cow(786442) calcium homeostasis modulator 3
cow(613539) calcium homeostasis modulator 3
dog(486872) calcium homeostasis modulator 3
sheep(101112615) calcium homeostasis modulator 3
naked mole-rat(101706006) calcium homeostasis modulator 3
domestic guinea pig(100722189) calcium homeostasis modulator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001129742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001129742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001129742 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182494 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047711 MISSION® esiRNA esiRNA human CALHM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182494 Rosetta Predictions human pricing
XM_001723060 Rosetta Predictions human pricing
XM_001725622 Rosetta Predictions human pricing
XM_001725818 Rosetta Predictions human pricing
XM_001059768 Rosetta Predictions rat pricing
XM_574682 Rosetta Predictions rat pricing
XM_001472011 Rosetta Predictions mouse pricing
XM_140729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196060 predicted 484
2 SASI_Hs01_00196061 predicted 1132
3 SASI_Hs01_00196062 predicted 1129
4 SASI_Hs01_00196063 predicted 605
5 SASI_Hs01_00196064 predicted 306
6 SASI_Hs01_00196065 predicted 426
7 SASI_Hs01_00196066 predicted 306
8 SASI_Hs01_00196067 predicted 1060
9 SASI_Hs01_00196068 predicted 613
10 SASI_Hs01_00196069 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452966 predicted 473
2 SASI_Hs02_00452967 predicted 1099
3 SASI_Hs02_00452968 predicted 1095
4 SASI_Hs02_00452969 predicted 594
5 SASI_Hs02_00452970 predicted 291
6 SASI_Hs02_00452971 predicted 297
7 SASI_Hs02_00452972 predicted 1037
8 SASI_Hs02_00452973 predicted 690
9 SASI_Hs02_00452974 predicted 1086
10 SASI_Hs02_00452975 predicted 710
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00468903 predicted 471
2 SASI_Hs02_00468904 predicted 1104
3 SASI_Hs02_00468905 predicted 1097
4 SASI_Hs02_00468906 predicted 595
5 SASI_Hs02_00468907 predicted 294
6 SASI_Hs02_00468908 predicted 298
7 SASI_Hs02_00468909 predicted 1032
8 SASI_Hs02_00468910 predicted 691
9 SASI_Hs02_00468911 predicted 1089
10 SASI_Hs02_00468912 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725818 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00470171 predicted 407
2 SASI_Hs02_00470172 predicted 474
3 SASI_Hs02_00470173 predicted 597
4 SASI_Hs02_00470174 predicted 471
5 SASI_Hs02_00470175 predicted 395
6 SASI_Hs02_00470176 predicted 559
7 SASI_Hs02_00470177 predicted 547
8 SASI_Hs02_00470178 predicted 547
9 SASI_Hs02_00470179 predicted 474
10 SASI_Hs02_00470180 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294272 predicted 631
2 SASI_Rn02_00294273 predicted 399
3 SASI_Rn02_00294274 predicted 467
4 SASI_Rn02_00294275 predicted 663
5 SASI_Rn02_00294276 predicted 556
6 SASI_Rn02_00294277 predicted 336
7 SASI_Rn02_00294278 predicted 324
8 SASI_Rn02_00294279 predicted 319
9 SASI_Rn02_00294280 predicted 596
10 SASI_Rn02_00294281 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402390 predicted 632
2 SASI_Rn02_00402391 predicted 394
3 SASI_Rn02_00402392 predicted 469
4 SASI_Rn02_00402393 predicted 667
5 SASI_Rn02_00402394 predicted 556
6 SASI_Rn02_00402395 predicted 335
7 SASI_Rn02_00402396 predicted 320
8 SASI_Rn02_00402397 predicted 320
9 SASI_Rn02_00402398 predicted 593
10 SASI_Rn02_00402399 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00358731 predicted 376
2 SASI_Mm02_00358732 predicted 638
3 SASI_Mm02_00358733 predicted 342
4 SASI_Mm02_00358734 predicted 367
5 SASI_Mm02_00358735 predicted 550
6 SASI_Mm02_00358736 predicted 336
7 SASI_Mm02_00358737 predicted 322
8 SASI_Mm02_00358738 predicted 656
9 SASI_Mm02_00358739 predicted 672
10 SASI_Mm02_00358740 predicted 509
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252102 predicted 376
2 SASI_Mm01_00252103 predicted 634
3 SASI_Mm01_00252104 predicted 347
4 SASI_Mm01_00252106 predicted 372
5 SASI_Mm01_00252108 predicted 556
6 SASI_Mm01_00252109 predicted 332
7 SASI_Mm01_00252110 predicted 320
8 SASI_Mm02_00424989 predicted 656
9 SASI_Mm02_00424990 predicted 673
10 SASI_Mm02_00424991 predicted 517
11 SASI_Mm01_00252101 predicted 472
12 SASI_Mm01_00252105 predicted 475
13 SASI_Mm01_00252107 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001129742
CALHM3 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 3
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000427890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129742.1-248s21c1
Sequence:CCGGAGCTCGGAGTCGGTGATGAATCTCGAGATTCATCACCGACTCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129742.1-1337s21c1
Sequence:CCGGAGGCACCCTAAGTCTTGTTAGCTCGAGCTAACAAGACTTAGGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001129742
CALHM3 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 3
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000427890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129742.1-248s21c1
Sequence:CCGGAGCTCGGAGTCGGTGATGAATCTCGAGATTCATCACCGACTCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129742.1-1337s21c1
Sequence:CCGGAGGCACCCTAAGTCTTGTTAGCTCGAGCTAACAAGACTTAGGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001129742
CALHM3 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 3
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000427890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001129742.1-248s21c1
Sequence:CCGGAGCTCGGAGTCGGTGATGAATCTCGAGATTCATCACCGACTCCGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001129742.1-1337s21c1
Sequence:CCGGAGGCACCCTAAGTCTTGTTAGCTCGAGCTAACAAGACTTAGGGTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182494
CALHM3 MISSION shRNA Bacterial Glycerol Stock
calcium homeostasis modulator 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-315s1c1
Sequence:CCGGCCTTTGACTTCAACTGTCCCTCTCGAGAGGGACAGTTGAAGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-847s1c1
Sequence:CCGGCAGATACTGGAGCAACTACGTCTCGAGACGTAGTTGCTCCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182494.1-1506s1c1
Sequence:CCGGCCGAGTCTGAGATTCTGCATTCTCGAGAATGCAGAATCTCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-299s1c1
Sequence:CCGGGTCAAGCTGTACTCCTCCTTTCTCGAGAAAGGAGGAGTACAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-608s1c1
Sequence:CCGGCCTGAGAAGTTTCTGGACTTTCTCGAGAAAGTCCAGAAACTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-307s1c1
Sequence:CCGGGTACTCCTCCTTTGACTTCAACTCGAGTTGAAGTCAAAGGAGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-616s1c1
Sequence:CCGGGTTTCTGGACTTTGCCAACATCTCGAGATGTTGGCAAAGTCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182494
CALHM3 MISSION shRNA shRNA Plasmid DNA
calcium homeostasis modulator 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-315s1c1
Sequence:CCGGCCTTTGACTTCAACTGTCCCTCTCGAGAGGGACAGTTGAAGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-847s1c1
Sequence:CCGGCAGATACTGGAGCAACTACGTCTCGAGACGTAGTTGCTCCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182494.1-1506s1c1
Sequence:CCGGCCGAGTCTGAGATTCTGCATTCTCGAGAATGCAGAATCTCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-299s1c1
Sequence:CCGGGTCAAGCTGTACTCCTCCTTTCTCGAGAAAGGAGGAGTACAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-608s1c1
Sequence:CCGGCCTGAGAAGTTTCTGGACTTTCTCGAGAAAGTCCAGAAACTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-307s1c1
Sequence:CCGGGTACTCCTCCTTTGACTTCAACTCGAGTTGAAGTCAAAGGAGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-616s1c1
Sequence:CCGGGTTTCTGGACTTTGCCAACATCTCGAGATGTTGGCAAAGTCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182494
CALHM3 MISSION shRNA Lentiviral Transduction Particles
calcium homeostasis modulator 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-315s1c1
Sequence:CCGGCCTTTGACTTCAACTGTCCCTCTCGAGAGGGACAGTTGAAGTCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-847s1c1
Sequence:CCGGCAGATACTGGAGCAACTACGTCTCGAGACGTAGTTGCTCCAGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182494.1-1506s1c1
Sequence:CCGGCCGAGTCTGAGATTCTGCATTCTCGAGAATGCAGAATCTCAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-299s1c1
Sequence:CCGGGTCAAGCTGTACTCCTCCTTTCTCGAGAAAGGAGGAGTACAGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182494.1-608s1c1
Sequence:CCGGCCTGAGAAGTTTCTGGACTTTCTCGAGAAAGTCCAGAAACTTCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154924    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-307s1c1
Sequence:CCGGGTACTCCTCCTTTGACTTCAACTCGAGTTGAAGTCAAAGGAGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182494.1-616s1c1
Sequence:CCGGGTTTCTGGACTTTGCCAACATCTCGAGATGTTGGCAAAGTCCAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks