EMAIL THIS PAGE TO A FRIEND

CALM1

calmodulin 1 (phosphorylase kinase, delta)

73 Gene Product Result for
Synonyms: CALML2 CAMI CPVT4 DD132 PHKD caM
Gene ID:
Human(801) Summary: This gene encodes a member of the EF-hand calcium-binding protein family. It is one of three genes which encode an identical calcium binding protein which is one of the four subunits of phosphorylase kinase. Two pseudogenes have been identified on chromosome 7 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
Mouse(12313) calmodulin 1
Rat(24242) calmodulin 1
domestic guinea pig(100734544) calmodulin 1 (phosphorylase kinase, delta)
naked mole-rat(101713746) calmodulin 1 (phosphorylase kinase, delta)
sheep(101115216) calmodulin 1 (phosphorylase kinase, delta)
chicken(396523) calmodulin 1 (phosphorylase kinase, delta)
cow(617095) calmodulin 1 (phosphorylase kinase, delta)
domestic cat(101094679) calmodulin 1 (phosphorylase kinase, delta)
dog(480416) calmodulin 1 (phosphorylase kinase, delta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA044999 Anti-CALM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4503194 Anti-Calmodulin antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504120 Anti-phospho-Calmodulin (pThr79+Ser81) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C7055 Monoclonal Anti-Calmodulin antibody produced in mouse clone 2D1+6D4+1F11, ascites fluid chicken, rat, Dictyostelium discoideum, bovine
microarray, western blot pricing
C3545 Monoclonal Anti-Calmodulin antibody produced in mouse clone 6D4, ascites fluid bovine, rat, Dictyostelium discoideum, chicken
western blot pricing
C0931 Monoclonal Anti-Calmodulin antibody produced in mouse clone 1F11, ascites fluid rat, bovine, chicken, Dictyostelium discoideum
western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
M4171 Melittin ≥97% (HPLC), synthetic human, mouse, rat pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M5280 Mastoparan, Vespula lewisii ≥97% (HPLC), powder human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009790 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009790 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009790 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006888 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006888 Rosetta Predictions human pricing
NM_031969 Rosetta Predictions rat pricing
XM_579543 Rosetta Predictions rat pricing
NM_009790 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016816 predicted 202
2 SASI_Hs01_00016817 predicted 210
3 SASI_Hs01_00016818 predicted 614
4 SASI_Hs01_00016819 predicted 475
5 SASI_Hs01_00016820 predicted 448
6 SASI_Hs01_00016821 predicted 333
7 SASI_Hs01_00016822 predicted 219
8 SASI_Hs01_00016823 predicted 526
9 SASI_Hs01_00016824 predicted 601
10 SASI_Hs01_00016825 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038080 predicted 1056
2 SASI_Rn01_00038081 predicted 374
3 SASI_Rn02_00265352 predicted 224
4 SASI_Rn02_00265353 predicted 249
5 SASI_Rn01_00038083 predicted 1047
6 SASI_Rn01_00038084 predicted 336
7 SASI_Rn01_00038086 predicted 308
8 SASI_Rn01_00038088 predicted 1051
9 SASI_Rn01_00038089 predicted 360
10 SASI_Rn02_00265354 predicted 250
11 SASI_Rn01_00038082 predicted 941
12 SASI_Rn01_00038085 predicted 948
13 SASI_Rn01_00038087 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185386 predicted 999
2 SASI_Rn01_00185387 predicted 314
3 SASI_Rn01_00185388 predicted 940
4 SASI_Rn01_00185389 predicted 988
5 SASI_Rn01_00185390 predicted 274
6 SASI_Rn01_00185391 predicted 955
7 SASI_Rn01_00185392 predicted 244
8 SASI_Rn01_00185393 predicted 230
9 SASI_Rn01_00185394 predicted 992
10 SASI_Rn01_00185395 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317032 predicted 644
2 SASI_Mm02_00317033 predicted 880
3 SASI_Mm02_00317034 predicted 514
4 SASI_Mm02_00317035 predicted 211
5 SASI_Mm02_00317036 predicted 215
6 SASI_Mm02_00317037 predicted 653
7 SASI_Mm02_00317038 predicted 887
8 SASI_Mm02_00317039 predicted 869
9 SASI_Mm02_00317040 predicted 885
10 SASI_Mm02_00317041 predicted 592
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009790
VALIDATED
CALM1 MISSION shRNA Bacterial Glycerol Stock
calmodulin 1 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-203s1c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009790.3-1966s1c1
Sequence:CCGGGCCGCTATACTTCTTTATTATCTCGAGATAATAAAGAAGTATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-492s1c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-227s1c1
Sequence:CCGGCCTATTCGATAAAGATGGTGACTCGAGTCACCATCTTTATCGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-324s1c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-571s21c1
Sequence:CCGGGCGACGGACAAGTCAACTATGCTCGAGCATAGTTGACTTGTCCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-849s21c1
Sequence:CCGGATACTCGTACTACCTTATAAGCTCGAGCTTATAAGGTAGTACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-324s21c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-203s21c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-492s21c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009790
VALIDATED
CALM1 MISSION shRNA shRNA Plasmid DNA
calmodulin 1 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-203s1c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009790.3-1966s1c1
Sequence:CCGGGCCGCTATACTTCTTTATTATCTCGAGATAATAAAGAAGTATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-492s1c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-227s1c1
Sequence:CCGGCCTATTCGATAAAGATGGTGACTCGAGTCACCATCTTTATCGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-324s1c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-571s21c1
Sequence:CCGGGCGACGGACAAGTCAACTATGCTCGAGCATAGTTGACTTGTCCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-849s21c1
Sequence:CCGGATACTCGTACTACCTTATAAGCTCGAGCTTATAAGGTAGTACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-324s21c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-203s21c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-492s21c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009790
VALIDATED
CALM1 MISSION shRNA Lentiviral Transduction Particles
calmodulin 1 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-203s1c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009790.3-1966s1c1
Sequence:CCGGGCCGCTATACTTCTTTATTATCTCGAGATAATAAAGAAGTATAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009790.3-492s1c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-227s1c1
Sequence:CCGGCCTATTCGATAAAGATGGTGACTCGAGTCACCATCTTTATCGAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009790.3-324s1c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-571s21c1
Sequence:CCGGGCGACGGACAAGTCAACTATGCTCGAGCATAGTTGACTTGTCCGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-849s21c1
Sequence:CCGGATACTCGTACTACCTTATAAGCTCGAGCTTATAAGGTAGTACGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-324s21c1
Sequence:CCGGGATATGATCAACGAAGTGGATCTCGAGATCCACTTCGTTGATCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009790.4-203s21c1
Sequence:CCGGTGCTGAATTCAAGGAAGCTTTCTCGAGAAAGCTTCCTTGAATTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009790.4-492s21c1
Sequence:CCGGCGCCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006888
CALM1 MISSION shRNA Bacterial Glycerol Stock
calmodulin 1 (phosphorylase kinase, delta)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-521s1c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-274s1c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-461s1c1
Sequence:CCGGCGTGAGGCATTCCGAGTCTTTCTCGAGAAAGACTCGGAATGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-337s1c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-602s1c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006888.3-3780s1c1
Sequence:CCGGCCTTTGGCAGTGACTAGATTTCTCGAGAAATCTAGTCACTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006888.3-350s1c1
Sequence:CCGGCAGGATATGATCAATGAAGTGCTCGAGCACTTCATTGATCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-602s21c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-337s21c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-521s21c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-274s21c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006888
CALM1 MISSION shRNA shRNA Plasmid DNA
calmodulin 1 (phosphorylase kinase, delta)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-521s1c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-274s1c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-461s1c1
Sequence:CCGGCGTGAGGCATTCCGAGTCTTTCTCGAGAAAGACTCGGAATGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-337s1c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-602s1c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006888.3-3780s1c1
Sequence:CCGGCCTTTGGCAGTGACTAGATTTCTCGAGAAATCTAGTCACTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006888.3-350s1c1
Sequence:CCGGCAGGATATGATCAATGAAGTGCTCGAGCACTTCATTGATCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-602s21c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-337s21c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-521s21c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-274s21c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006888
CALM1 MISSION shRNA Lentiviral Transduction Particles
calmodulin 1 (phosphorylase kinase, delta)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-521s1c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-274s1c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-461s1c1
Sequence:CCGGCGTGAGGCATTCCGAGTCTTTCTCGAGAAAGACTCGGAATGCCTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-337s1c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006888.2-602s1c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006888.3-3780s1c1
Sequence:CCGGCCTTTGGCAGTGACTAGATTTCTCGAGAAATCTAGTCACTGCCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006888.3-350s1c1
Sequence:CCGGCAGGATATGATCAATGAAGTGCTCGAGCACTTCATTGATCATATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-602s21c1
Sequence:CCGGGACGGACAAGTCAACTATGAACTCGAGTTCATAGTTGACTTGTCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-337s21c1
Sequence:CCGGAGAAGCTGAATTGCAGGATATCTCGAGATATCCTGCAATTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-521s21c1
Sequence:CCGGCGTCACGTCATGACAAACTTACTCGAGTAAGTTTGTCATGACGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006888.3-274s21c1
Sequence:CCGGCGATGGCACCATCACAACAAACTCGAGTTTGTTGTGATGGTGCCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks