EMAIL THIS PAGE TO A FRIEND

CALM2

calmodulin 2 (phosphorylase kinase, delta)

67 Gene Product Result for
Synonyms: CAMII PHKD PHKD2
Gene ID:
Mouse(12314) calmodulin 2
Rat(50663) calmodulin 2
domestic cat(101081534) calmodulin 2 (phosphorylase kinase, delta)
cow(100297344) calmodulin 2 (phosphorylase kinase, delta)
dog(474584) calmodulin 2 (phosphorylase kinase, delta)
sheep(443230) calmodulin 2 (phosphorylase kinase, delta)
Domestic Rabbit(100352392) calmodulin 2 (phosphorylase kinase, delta)
naked mole-rat(101704751) calmodulin 2 (phosphorylase kinase, delta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001743 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001743 Rosetta Predictions human pricing
NM_017326 Rosetta Predictions rat pricing
NM_007589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115485 predicted 571
2 SASI_Hs02_00332461 predicted 203
3 SASI_Hs02_00332462 predicted 598
4 SASI_Hs01_00115486 predicted 310
5 SASI_Hs01_00115489 predicted 526
6 SASI_Hs02_00332463 predicted 200
7 SASI_Hs01_00115490 predicted 252
8 SASI_Hs01_00115492 predicted 295
9 SASI_Hs02_00332464 predicted 260
10 SASI_Hs01_00115493 predicted 509
11 SASI_Hs01_00115487 predicted 368
12 SASI_Hs01_00115488 predicted 595
13 SASI_Hs01_00115491 predicted 469
14 SASI_Hs01_00115494 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017326 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261775 predicted 467
2 SASI_Rn02_00261776 predicted 483
3 SASI_Rn02_00261777 predicted 404
4 SASI_Rn02_00261778 predicted 473
5 SASI_Rn01_00051209 predicted 511
6 SASI_Rn01_00051212 predicted 603
7 SASI_Rn01_00051216 predicted 507
8 SASI_Rn01_00051217 predicted 573
9 SASI_Rn02_00261779 predicted 611
10 SASI_Rn02_00261780 predicted 516
11 SASI_Rn01_00051208 predicted 317
12 SASI_Rn01_00051210 predicted 231
13 SASI_Rn01_00051211 predicted 267
14 SASI_Rn01_00051213 predicted 311
15 SASI_Rn01_00051214 predicted 423
16 SASI_Rn01_00051215 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163316 predicted 894
2 SASI_Mm01_00163317 predicted 835
3 SASI_Mm01_00163320 predicted 852
4 SASI_Mm01_00163321 predicted 866
5 SASI_Mm01_00163322 predicted 885
6 SASI_Mm01_00163324 predicted 834
7 SASI_Mm02_00311991 predicted 885
8 SASI_Mm02_00311992 predicted 888
9 SASI_Mm02_00311993 predicted 906
10 SASI_Mm02_00311994 predicted 474
11 SASI_Mm01_00163315 predicted 258
12 SASI_Mm01_00163318 predicted 233
13 SASI_Mm01_00163319 predicted 247
14 SASI_Mm01_00163323 predicted 252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001743
VALIDATED
CALM2 MISSION shRNA Bacterial Glycerol Stock
calmodulin 2 (phosphorylase kinase, delta)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-224s21c1
Sequence:GTACCGGAGATGGTGATGGAACTATAACCTCGAGGTTATAGTTCCATCACCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-558s21c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-576s21c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-513s21c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-1040s21c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-495s1c1
Sequence:CCGGGTACAAATGATGACAGCAAAGCTCGAGCTTTGCTGTCATCATTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-950s1c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-486s1c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-423s1c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-207s1c1
Sequence:CCGGGCAGAGTTACAGGACATGATTCTCGAGAATCATGTCCTGTAACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001743.3-130s1c1
Sequence:CCGGACAAAGATGGTGATGGAACTACTCGAGTAGTTCCATCACCATCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-139s1c1
Sequence:CCGGGTGATGGAACTATAACAACAACTCGAGTTGTTGTTATAGTTCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-468s1c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-327s1c1
Sequence:CCGGAGAGAAGCATTCCGTGTGTTTCTCGAGAAACACACGGAATGCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001743
VALIDATED
CALM2 MISSION shRNA shRNA Plasmid DNA
calmodulin 2 (phosphorylase kinase, delta)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-224s21c1
Sequence:GTACCGGAGATGGTGATGGAACTATAACCTCGAGGTTATAGTTCCATCACCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-558s21c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-576s21c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-513s21c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-1040s21c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-495s1c1
Sequence:CCGGGTACAAATGATGACAGCAAAGCTCGAGCTTTGCTGTCATCATTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-950s1c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-486s1c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-423s1c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-207s1c1
Sequence:CCGGGCAGAGTTACAGGACATGATTCTCGAGAATCATGTCCTGTAACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001743.3-130s1c1
Sequence:CCGGACAAAGATGGTGATGGAACTACTCGAGTAGTTCCATCACCATCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-139s1c1
Sequence:CCGGGTGATGGAACTATAACAACAACTCGAGTTGTTGTTATAGTTCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-468s1c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-327s1c1
Sequence:CCGGAGAGAAGCATTCCGTGTGTTTCTCGAGAAACACACGGAATGCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001743
VALIDATED
CALM2 MISSION shRNA Lentiviral Transduction Particles
calmodulin 2 (phosphorylase kinase, delta)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-224s21c1
Sequence:GTACCGGAGATGGTGATGGAACTATAACCTCGAGGTTATAGTTCCATCACCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-558s21c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-576s21c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-513s21c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001743.4-1040s21c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-495s1c1
Sequence:CCGGGTACAAATGATGACAGCAAAGCTCGAGCTTTGCTGTCATCATTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-950s1c1
Sequence:CCGGCCAGGTACTCGTACACTATTTCTCGAGAAATAGTGTACGAGTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001743.3-486s1c1
Sequence:CCGGGAAGAGTTTGTACAAATGATGCTCGAGCATCATTTGTACAAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_001743.3-423s1c1
Sequence:CCGGGATGAAGAAGTTGATGAAATGCTCGAGCATTTCATCAACTTCTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-207s1c1
Sequence:CCGGGCAGAGTTACAGGACATGATTCTCGAGAATCATGTCCTGTAACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001743.3-130s1c1
Sequence:CCGGACAAAGATGGTGATGGAACTACTCGAGTAGTTCCATCACCATCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-139s1c1
Sequence:CCGGGTGATGGAACTATAACAACAACTCGAGTTGTTGTTATAGTTCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-468s1c1
Sequence:CCGGGATGGTCAAGTAAACTATGAACTCGAGTTCATAGTTTACTTGACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001743.3-327s1c1
Sequence:CCGGAGAGAAGCATTCCGTGTGTTTCTCGAGAAACACACGGAATGCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007589
VALIDATED
CALM2 MISSION shRNA Bacterial Glycerol Stock
calmodulin 2 (phosphorylase kinase, delta)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-1021s21c1
Sequence:CCGGCCAGGTACTCGGACACTATTTCTCGAGAAATAGTGTCCGAGTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-578s21c1
Sequence:CCGGGACAGCGAAGTGAAGACATTGCTCGAGCAATGTCTTCACTTCGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007589.5-459s21c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-424s21c1
Sequence:CCGGAGGATGGCAATGGCTATATTACTCGAGTAATATAGCCATTGCCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-317s21c1
Sequence:CCGGTGGTAATGGCACAATTGATTTCTCGAGAAATCAATTGTGCCATTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-390s1c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-345s1c1
Sequence:CCGGGTGTTTGATAAGGATGGCAATCTCGAGATTGCCATCCTTATCAAACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-477s1c1
Sequence:CCGGCAGGTAAACTACGAAGAGTTTCTCGAGAAACTCTTCGTAGTTTACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-269s1c1
Sequence:CCGGCCCTGAATTTCTGACAATGATCTCGAGATCATTGTCAGAAATTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007589
VALIDATED
CALM2 MISSION shRNA shRNA Plasmid DNA
calmodulin 2 (phosphorylase kinase, delta)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-1021s21c1
Sequence:CCGGCCAGGTACTCGGACACTATTTCTCGAGAAATAGTGTCCGAGTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-578s21c1
Sequence:CCGGGACAGCGAAGTGAAGACATTGCTCGAGCAATGTCTTCACTTCGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007589.5-459s21c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-424s21c1
Sequence:CCGGAGGATGGCAATGGCTATATTACTCGAGTAATATAGCCATTGCCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-317s21c1
Sequence:CCGGTGGTAATGGCACAATTGATTTCTCGAGAAATCAATTGTGCCATTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-390s1c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-345s1c1
Sequence:CCGGGTGTTTGATAAGGATGGCAATCTCGAGATTGCCATCCTTATCAAACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-477s1c1
Sequence:CCGGCAGGTAAACTACGAAGAGTTTCTCGAGAAACTCTTCGTAGTTTACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-269s1c1
Sequence:CCGGCCCTGAATTTCTGACAATGATCTCGAGATCATTGTCAGAAATTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007589
VALIDATED
CALM2 MISSION shRNA Lentiviral Transduction Particles
calmodulin 2 (phosphorylase kinase, delta)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338089    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-1021s21c1
Sequence:CCGGCCAGGTACTCGGACACTATTTCTCGAGAAATAGTGTCCGAGTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-578s21c1
Sequence:CCGGGACAGCGAAGTGAAGACATTGCTCGAGCAATGTCTTCACTTCGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007589.5-459s21c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-424s21c1
Sequence:CCGGAGGATGGCAATGGCTATATTACTCGAGTAATATAGCCATTGCCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007589.5-317s21c1
Sequence:CCGGTGGTAATGGCACAATTGATTTCTCGAGAAATCAATTGTGCCATTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-390s1c1
Sequence:CCGGCGCCATGTGATGACAAACCTTCTCGAGAAGGTTTGTCATCACATGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-345s1c1
Sequence:CCGGGTGTTTGATAAGGATGGCAATCTCGAGATTGCCATCCTTATCAAACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007589.4-477s1c1
Sequence:CCGGCAGGTAAACTACGAAGAGTTTCTCGAGAAACTCTTCGTAGTTTACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007589.4-269s1c1
Sequence:CCGGCCCTGAATTTCTGACAATGATCTCGAGATCATTGTCAGAAATTCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)