EMAIL THIS PAGE TO A FRIEND

CALM3

calmodulin 3 (phosphorylase kinase, delta)

329 Gene Product Result for
Synonyms: PHKD PHKD3
Gene ID:
Mouse(12315) calmodulin 3
Rat(24244) calmodulin 3
domestic cat(101091063) calmodulin 3 (phosphorylase kinase, delta)
cow(520277) calmodulin 3 (phosphorylase kinase, delta)
dog(476428) calmodulin 3 (phosphorylase kinase, delta)
naked mole-rat(101724181) calmodulin 3 (phosphorylase kinase, delta)
sheep(101116338) calmodulin 3 (phosphorylase kinase, delta)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007590 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007590 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007590 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005184 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU143521 MISSION® esiRNA esiRNA human CALM3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005184 Rosetta Predictions human pricing
NM_012518 Rosetta Predictions rat pricing
NM_007590 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005184 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200216 predicted 968
2 SASI_Hs01_00200217 predicted 1054
3 SASI_Hs01_00200218 predicted 1073
4 SASI_Hs01_00200219 predicted 1076
5 SASI_Hs01_00200220 predicted 416
6 SASI_Hs01_00200221 predicted 378
7 SASI_Hs01_00200222 predicted 355
8 SASI_Hs01_00200223 predicted 313
9 SASI_Hs01_00200224 predicted 1097
10 SASI_Hs01_00200225 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259583 predicted 271
2 SASI_Rn02_00259584 predicted 227
3 SASI_Rn02_00259585 predicted 367
4 SASI_Rn02_00259586 predicted 223
5 SASI_Rn02_00259587 predicted 224
6 SASI_Rn01_00105829 predicted 353
7 SASI_Rn01_00105831 predicted 215
8 SASI_Rn02_00259588 predicted 247
9 SASI_Rn02_00259589 predicted 319
10 SASI_Rn02_00259590 predicted 314
11 SASI_Rn01_00105823 predicted 634
12 SASI_Rn01_00105824 predicted 509
13 SASI_Rn01_00105825 predicted 267
14 SASI_Rn01_00105826 predicted 696
15 SASI_Rn01_00105827 predicted 693
16 SASI_Rn01_00105828 predicted 655
17 SASI_Rn01_00105830 predicted 581
18 SASI_Rn01_00105832 predicted 249
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007590 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311995 predicted 775
2 SASI_Mm02_00311996 predicted 771
3 SASI_Mm02_00311997 predicted 858
4 SASI_Mm02_00311998 predicted 875
5 SASI_Mm02_00311999 predicted 810
6 SASI_Mm02_00312000 predicted 251
7 SASI_Mm02_00312001 predicted 225
8 SASI_Mm02_00312002 predicted 246
9 SASI_Mm02_00312003 predicted 1102
10 SASI_Mm02_00312004 predicted 1093
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007590
VALIDATED
CALM3 MISSION shRNA Bacterial Glycerol Stock
calmodulin 3 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-516s1c1
Sequence:CCGGCCAGGTCAATTATGAAGAGTTCTCGAGAACTCTTCATAATTGACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-166s1c1
Sequence:CCGGCTCTTCGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCGAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-331s1c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-309s1c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-385s1c1
Sequence:CCGGGTCTTTGACAAGGATGGGAATCTCGAGATTCCCATCCTTGTCAAAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-387s21c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-409s21c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-255s21c1
Sequence:CCGGGGATGGAGATGGCACCATTACCTCGAGGTAATGGTGCCATCTCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-487s21c1
Sequence:CCGGTATATTAGCGCTGCCGAGCTGCTCGAGCAGCTCGGCAGCGCTAATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-875s21c1
Sequence:CCGGTGATGCATTCACAAGGTGAACCTCGAGGTTCACCTTGTGAATGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007590
VALIDATED
CALM3 MISSION shRNA shRNA Plasmid DNA
calmodulin 3 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-516s1c1
Sequence:CCGGCCAGGTCAATTATGAAGAGTTCTCGAGAACTCTTCATAATTGACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-166s1c1
Sequence:CCGGCTCTTCGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCGAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-331s1c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-309s1c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-385s1c1
Sequence:CCGGGTCTTTGACAAGGATGGGAATCTCGAGATTCCCATCCTTGTCAAAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-387s21c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-409s21c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-255s21c1
Sequence:CCGGGGATGGAGATGGCACCATTACCTCGAGGTAATGGTGCCATCTCCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-487s21c1
Sequence:CCGGTATATTAGCGCTGCCGAGCTGCTCGAGCAGCTCGGCAGCGCTAATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-875s21c1
Sequence:CCGGTGATGCATTCACAAGGTGAACCTCGAGGTTCACCTTGTGAATGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007590
VALIDATED
CALM3 MISSION shRNA Lentiviral Transduction Particles
calmodulin 3 (phosphorylase kinase, delta)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-516s1c1
Sequence:CCGGCCAGGTCAATTATGAAGAGTTCTCGAGAACTCTTCATAATTGACCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-166s1c1
Sequence:CCGGCTCTTCGACAAGGATGGAGATCTCGAGATCTCCATCCTTGTCGAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-331s1c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-309s1c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007590.2-385s1c1
Sequence:CCGGGTCTTTGACAAGGATGGGAATCTCGAGATTCCCATCCTTGTCAAAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-387s21c1
Sequence:CCGGCCCAGAGTTCTTGACCATGATCTCGAGATCATGGTCAAGAACTCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-409s21c1
Sequence:CCGGGCCAGAAAGATGAAGGATACACTCGAGTGTATCCTTCATCTTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279453    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-255s21c1
Sequence:CCGGGGATGGAGATGGCACCATTACCTCGAGGTAATGGTGCCATCTCCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-487s21c1
Sequence:CCGGTATATTAGCGCTGCCGAGCTGCTCGAGCAGCTCGGCAGCGCTAATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281694    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007590.3-875s21c1
Sequence:CCGGTGATGCATTCACAAGGTGAACCTCGAGGTTCACCTTGTGAATGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005184
VALIDATED
CALM3 MISSION shRNA Bacterial Glycerol Stock
calmodulin 3 (phosphorylase kinase, delta)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-185s1c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.1-304s1c1
Sequence:CCGGCTTCCAGGGAACGGGACCATTCTCGAGAATGGTCCCGTTCCCTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-391s1c1
Sequence:CCGGCGAGAGGCGTTCCGTGTCTTTCTCGAGAAAGACACGGAACGCCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-536s1c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-544s1c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-388s1c1
Sequence:CCGGCTGACCATGATGGCCAGAAAGCTCGAGCTTTCTGGCCATCATGGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-598s1c1
Sequence:CCGGGAAGAGTTTGTACAGATGATGCTCGAGCATCATCTGTACAAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-401s1c1
Sequence:CCGGCCAGAAAGATGAAGGACACAGCTCGAGCTGTGTCCTTCATCTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-875s1c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-607s1c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.2-499s1c1
Sequence:CCGGCGTCACGTAATGACGAACCTGCTCGAGCAGGTTCGTCATTACGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-875s21c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-544s21c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-584s21c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-242s21c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-607s21c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005184
VALIDATED
CALM3 MISSION shRNA shRNA Plasmid DNA
calmodulin 3 (phosphorylase kinase, delta)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-185s1c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.1-304s1c1
Sequence:CCGGCTTCCAGGGAACGGGACCATTCTCGAGAATGGTCCCGTTCCCTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-391s1c1
Sequence:CCGGCGAGAGGCGTTCCGTGTCTTTCTCGAGAAAGACACGGAACGCCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-536s1c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-544s1c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-388s1c1
Sequence:CCGGCTGACCATGATGGCCAGAAAGCTCGAGCTTTCTGGCCATCATGGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-598s1c1
Sequence:CCGGGAAGAGTTTGTACAGATGATGCTCGAGCATCATCTGTACAAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-401s1c1
Sequence:CCGGCCAGAAAGATGAAGGACACAGCTCGAGCTGTGTCCTTCATCTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-875s1c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-607s1c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.2-499s1c1
Sequence:CCGGCGTCACGTAATGACGAACCTGCTCGAGCAGGTTCGTCATTACGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-875s21c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-544s21c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-584s21c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-242s21c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-607s21c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005184
VALIDATED
CALM3 MISSION shRNA Lentiviral Transduction Particles
calmodulin 3 (phosphorylase kinase, delta)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-185s1c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.1-304s1c1
Sequence:CCGGCTTCCAGGGAACGGGACCATTCTCGAGAATGGTCCCGTTCCCTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-391s1c1
Sequence:CCGGCGAGAGGCGTTCCGTGTCTTTCTCGAGAAAGACACGGAACGCCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.1-536s1c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-544s1c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-388s1c1
Sequence:CCGGCTGACCATGATGGCCAGAAAGCTCGAGCTTTCTGGCCATCATGGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-598s1c1
Sequence:CCGGGAAGAGTTTGTACAGATGATGCTCGAGCATCATCTGTACAAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195538    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005184.2-401s1c1
Sequence:CCGGCCAGAAAGATGAAGGACACAGCTCGAGCTGTGTCCTTCATCTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-875s1c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005184.2-607s1c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005184.2-499s1c1
Sequence:CCGGCGTCACGTAATGACGAACCTGCTCGAGCAGGTTCGTCATTACGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-875s21c1
Sequence:CCGGCAAGGCCTGATGCATTCATAACTCGAGTTATGAATGCATCAGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-544s21c1
Sequence:CCGGGTGGATGAGATGATCAGGGAGCTCGAGCTCCCTGATCATCTCATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-584s21c1
Sequence:CCGGGCCAGGTCAATTATGAAGAGTCTCGAGACTCTTCATAATTGACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-242s21c1
Sequence:CCGGACAAGGATGGAGATGGCACTACTCGAGTAGTGCCATCTCCATCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005184.2-607s21c1
Sequence:CCGGGTACAGATGATGACTGCAAAGCTCGAGCTTTGCAGTCATCATCTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)