EMAIL THIS PAGE TO A FRIEND

CALML3

calmodulin-like 3

59 Gene Product Result for
Synonyms: CLP
UniProtKB ID: P27482, B2R9V6, Q5SQI4
Gene ID:
Mouse(70405) calmodulin-like 3
Rat(307100) calmodulin-like 3
naked mole-rat(101716865) calmodulin-like 3
domestic guinea pig(100728342) calmodulin-like 3
Goat(100861110) calmodulin-like 3
chicken(416692) calmodulin-like 3
domestic cat(101099307) calmodulin-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005185 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005185 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005185 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027416 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027416 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027416 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135781 MISSION® esiRNA esiRNA human CALML3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005185 Rosetta Predictions human pricing
NM_001012054 Rosetta Predictions rat pricing
XM_577597 Rosetta Predictions rat pricing
NM_027416 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005185 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153356 predicted 326
2 SASI_Hs01_00153357 predicted 538
3 SASI_Hs01_00153358 predicted 873
4 SASI_Hs01_00153359 predicted 924
5 SASI_Hs01_00153360 predicted 268
6 SASI_Hs01_00153361 predicted 524
7 SASI_Hs01_00153362 predicted 830
8 SASI_Hs01_00153363 predicted 978
9 SASI_Hs01_00153364 predicted 820
10 SASI_Hs02_00339132 predicted 836
11 SASI_Hs01_00153355 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012054 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036883 predicted 491
2 SASI_Rn01_00036884 predicted 587
3 SASI_Rn01_00036885 predicted 238
4 SASI_Rn01_00036886 predicted 610
5 SASI_Rn01_00036887 predicted 615
6 SASI_Rn01_00036888 predicted 642
7 SASI_Rn01_00036889 predicted 579
8 SASI_Rn01_00036890 predicted 399
9 SASI_Rn01_00036891 predicted 636
10 SASI_Rn01_00036892 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00188562 predicted 215
2 SASI_Rn01_00188563 predicted 218
3 SASI_Rn01_00188564 predicted 142
4 SASI_Rn01_00188565 predicted 39
5 SASI_Rn01_00188566 predicted 94
6 SASI_Rn01_00188567 predicted 321
7 SASI_Rn01_00188568 predicted 303
8 SASI_Rn01_00188569 predicted 85
9 SASI_Rn01_00188570 predicted 27
10 SASI_Rn01_00188571 predicted 91
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027416 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045394 predicted 542
2 SASI_Mm01_00045395 predicted 688
3 SASI_Mm01_00045396 predicted 463
4 SASI_Mm01_00045397 predicted 469
5 SASI_Mm01_00045398 predicted 600
6 SASI_Mm01_00045399 predicted 592
7 SASI_Mm01_00045400 predicted 251
8 SASI_Mm01_00045401 predicted 392
9 SASI_Mm01_00045402 predicted 482
10 SASI_Mm01_00045403 predicted 377
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005185
CALML3 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-272s1c1
Sequence:CCGGGCGGGACATGATGAGTGAGATCTCGAGATCTCACTCATCATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-398s1c1
Sequence:CCGGCGTGTTCGACAAGGACGGCAACTCGAGTTGCCGTCCTTGTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-542s1c1
Sequence:CCGGCGAGGAGTTTGTCCGTGTGCTCTCGAGAGCACACGGACAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-154s1c1
Sequence:CCGGTCACAGAATTCAAGGAGGCCTCTCGAGAGGCCTCCTTGAATTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-521s1c1
Sequence:CCGGCGGAGACGGACAGGTGAACTACTCGAGTAGTTCACCTGTCCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-529s21c1
Sequence:CCGGGACAGGTGAACTACGAGGAGTCTCGAGACTCCTCGTAGTTCACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005185.2-830s21c1
Sequence:CCGGGAGAAGCAGAGCTGACCTTAGCTCGAGCTAAGGTCAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-553s21c1
Sequence:CCGGTCCGTGTGCTGGTGTCCAAGTCTCGAGACTTGGACACCAGCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005185
CALML3 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-272s1c1
Sequence:CCGGGCGGGACATGATGAGTGAGATCTCGAGATCTCACTCATCATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-398s1c1
Sequence:CCGGCGTGTTCGACAAGGACGGCAACTCGAGTTGCCGTCCTTGTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-542s1c1
Sequence:CCGGCGAGGAGTTTGTCCGTGTGCTCTCGAGAGCACACGGACAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-154s1c1
Sequence:CCGGTCACAGAATTCAAGGAGGCCTCTCGAGAGGCCTCCTTGAATTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-521s1c1
Sequence:CCGGCGGAGACGGACAGGTGAACTACTCGAGTAGTTCACCTGTCCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-529s21c1
Sequence:CCGGGACAGGTGAACTACGAGGAGTCTCGAGACTCCTCGTAGTTCACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005185.2-830s21c1
Sequence:CCGGGAGAAGCAGAGCTGACCTTAGCTCGAGCTAAGGTCAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-553s21c1
Sequence:CCGGTCCGTGTGCTGGTGTCCAAGTCTCGAGACTTGGACACCAGCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005185
CALML3 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-272s1c1
Sequence:CCGGGCGGGACATGATGAGTGAGATCTCGAGATCTCACTCATCATGTCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-398s1c1
Sequence:CCGGCGTGTTCGACAAGGACGGCAACTCGAGTTGCCGTCCTTGTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-542s1c1
Sequence:CCGGCGAGGAGTTTGTCCGTGTGCTCTCGAGAGCACACGGACAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-154s1c1
Sequence:CCGGTCACAGAATTCAAGGAGGCCTCTCGAGAGGCCTCCTTGAATTCTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005185.2-521s1c1
Sequence:CCGGCGGAGACGGACAGGTGAACTACTCGAGTAGTTCACCTGTCCGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-529s21c1
Sequence:CCGGGACAGGTGAACTACGAGGAGTCTCGAGACTCCTCGTAGTTCACCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438576    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005185.2-830s21c1
Sequence:CCGGGAGAAGCAGAGCTGACCTTAGCTCGAGCTAAGGTCAGCTCTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005185.2-553s21c1
Sequence:CCGGTCCGTGTGCTGGTGTCCAAGTCTCGAGACTTGGACACCAGCACACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027416
CALML3 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027416.1-722s1c1
Sequence:CCGGCCTTTCACTTTCTGCATCTTACTCGAGTAAGATGCAGAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-255s1c1
Sequence:CCGGGAGCTTCAAGGCATGGTGAATCTCGAGATTCACCATGCCTTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-143s1c1
Sequence:CCGGCGCCGAGTTCAAAGAGGCTTTCTCGAGAAAGCCTCTTTGAACTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-266s1c1
Sequence:CCGGCATGGTGAATGAAATTGACAACTCGAGTTGTCAATTTCATTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-518s1c1
Sequence:CCGGGCAAGTGAACTATGAGGAGTTCTCGAGAACTCCTCATAGTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027416
CALML3 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027416.1-722s1c1
Sequence:CCGGCCTTTCACTTTCTGCATCTTACTCGAGTAAGATGCAGAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-255s1c1
Sequence:CCGGGAGCTTCAAGGCATGGTGAATCTCGAGATTCACCATGCCTTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-143s1c1
Sequence:CCGGCGCCGAGTTCAAAGAGGCTTTCTCGAGAAAGCCTCTTTGAACTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-266s1c1
Sequence:CCGGCATGGTGAATGAAATTGACAACTCGAGTTGTCAATTTCATTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-518s1c1
Sequence:CCGGGCAAGTGAACTATGAGGAGTTCTCGAGAACTCCTCATAGTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027416
CALML3 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027416.1-722s1c1
Sequence:CCGGCCTTTCACTTTCTGCATCTTACTCGAGTAAGATGCAGAAAGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-255s1c1
Sequence:CCGGGAGCTTCAAGGCATGGTGAATCTCGAGATTCACCATGCCTTGAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-143s1c1
Sequence:CCGGCGCCGAGTTCAAAGAGGCTTTCTCGAGAAAGCCTCTTTGAACTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-266s1c1
Sequence:CCGGCATGGTGAATGAAATTGACAACTCGAGTTGTCAATTTCATTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027416.1-518s1c1
Sequence:CCGGGCAAGTGAACTATGAGGAGTTCTCGAGAACTCCTCATAGTTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks