EMAIL THIS PAGE TO A FRIEND

CALML5

calmodulin-like 5

40 Gene Product Result for
Synonyms: CLSP
UniProtKB ID: Q9NZT1, Q5SQI3, Q8IXU8
Gene ID:
Human(51806) Summary: This gene encodes a novel calcium binding protein expressed in the epidermis and related to the calmodulin family of calcium binding proteins. Functional studies with recombinant protein demonstrate it does bind calcium and undergoes a conformational change when it does so. Abundant expression is detected only in reconstructed epidermis and is restricted to differentiating keratinocytes. In addition, it can associate with transglutaminase 3, shown to be a key enzyme in the terminal differentiation of keratinocytes. [provided by RefSeq, Jul 2008]
Rat(364774) calmodulin-like 5
cow(520404) calmodulin-like 5
dog(487146) calmodulin-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017422 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159491 MISSION® esiRNA esiRNA human CALML5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017422 Rosetta Predictions human pricing
XM_001062982 Rosetta Predictions rat pricing
XM_344627 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186508 predicted 235
2 SASI_Hs01_00186510 predicted 242
3 SASI_Hs02_00349992 predicted 241
4 SASI_Hs01_00186511 predicted 334
5 SASI_Hs01_00186512 predicted 292
6 SASI_Hs01_00186513 predicted 279
7 SASI_Hs01_00186514 predicted 205
8 SASI_Hs01_00186515 predicted 495
9 SASI_Hs01_00186516 predicted 495
10 SASI_Hs01_00186517 predicted 573
11 SASI_Hs01_00186509 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305329 predicted 399
2 SASI_Rn02_00305330 predicted 406
3 SASI_Rn02_00305331 predicted 268
4 SASI_Rn02_00305332 predicted 302
5 SASI_Rn02_00305333 predicted 263
6 SASI_Rn02_00305334 predicted 443
7 SASI_Rn02_00305335 predicted 329
8 SASI_Rn02_00305336 predicted 426
9 SASI_Rn02_00305337 predicted 210
10 SASI_Rn02_00305338 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397342 predicted 397
2 SASI_Rn02_00397343 predicted 404
3 SASI_Rn02_00397344 predicted 272
4 SASI_Rn02_00397345 predicted 304
5 SASI_Rn02_00397346 predicted 264
6 SASI_Rn02_00397347 predicted 443
7 SASI_Rn02_00397348 predicted 326
8 SASI_Rn02_00397349 predicted 429
9 SASI_Rn02_00397350 predicted 213
10 SASI_Rn02_00397351 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017422
CALML5 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-514s1c1
Sequence:CCGGCTACGAGGAGTTCGCGAGGATCTCGAGATCCTCGCGAACTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-257s1c1
Sequence:CCGGAGGAAACTCATCTCCGAGGTTCTCGAGAACCTCGGAGATGAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-295s1c1
Sequence:CCGGCGAAATCAGCTTCCAGGAGTTCTCGAGAACTCCTGGAAGCTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-163s1c1
Sequence:CCGGCGCGGTTGACACGGATGGAAACTCGAGTTTCCATCCGTGTCAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-172s1c1
Sequence:CCGGCACGGATGGAAACGGCACCATCTCGAGATGGTGCCGTTTCCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017422
CALML5 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-514s1c1
Sequence:CCGGCTACGAGGAGTTCGCGAGGATCTCGAGATCCTCGCGAACTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-257s1c1
Sequence:CCGGAGGAAACTCATCTCCGAGGTTCTCGAGAACCTCGGAGATGAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-295s1c1
Sequence:CCGGCGAAATCAGCTTCCAGGAGTTCTCGAGAACTCCTGGAAGCTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-163s1c1
Sequence:CCGGCGCGGTTGACACGGATGGAAACTCGAGTTTCCATCCGTGTCAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-172s1c1
Sequence:CCGGCACGGATGGAAACGGCACCATCTCGAGATGGTGCCGTTTCCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017422
CALML5 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-514s1c1
Sequence:CCGGCTACGAGGAGTTCGCGAGGATCTCGAGATCCTCGCGAACTCCTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-257s1c1
Sequence:CCGGAGGAAACTCATCTCCGAGGTTCTCGAGAACCTCGGAGATGAGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-295s1c1
Sequence:CCGGCGAAATCAGCTTCCAGGAGTTCTCGAGAACTCCTGGAAGCTGATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-163s1c1
Sequence:CCGGCGCGGTTGACACGGATGGAAACTCGAGTTTCCATCCGTGTCAACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017422.3-172s1c1
Sequence:CCGGCACGGATGGAAACGGCACCATCTCGAGATGGTGCCGTTTCCATCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks