EMAIL THIS PAGE TO A FRIEND

CALML6

calmodulin-like 6

19 Gene Product Result for
Synonyms: CAGLP
UniProtKB ID: Q8TD86, A2A2M3, Q6Q2C4
Gene ID:
naked mole-rat(101712577) calmodulin-like 6
sheep(101123572) calmodulin-like 6
dog(607269) calmodulin-like 6
domestic cat(101086824) calmodulin-like 6
cow(617412) calmodulin-like 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138705 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136451 MISSION® esiRNA esiRNA human CALML6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138705 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050214 predicted 704
2 SASI_Hs01_00050215 predicted 734
3 SASI_Hs01_00050216 predicted 514
4 SASI_Hs01_00050218 predicted 503
5 SASI_Hs01_00050219 predicted 703
6 SASI_Hs01_00050220 predicted 790
7 SASI_Hs01_00050221 predicted 572
8 SASI_Hs01_00050222 predicted 657
9 SASI_Hs02_00363810 predicted 679
10 SASI_Hs01_00050223 predicted 627
11 SASI_Hs01_00050217 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138705
CALML6 MISSION shRNA Bacterial Glycerol Stock
calmodulin-like 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-404s1c1
Sequence:CCGGCCTGGCACTAATGGGAGTTTACTCGAGTAAACTCCCATTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-512s1c1
Sequence:CCGGCACACTCAAGTACGTGCTAATCTCGAGATTAGCACGTACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-395s1c1
Sequence:CCGGCGATGGTTTCCTGGCACTAATCTCGAGATTAGTGCCAGGAAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-236s1c1
Sequence:CCGGCAAGGGAGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-368s1c1
Sequence:CCGGCAGAGACAACAAAGGGTTCTTCTCGAGAAGAACCCTTTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-511s21c1
Sequence:CCGGCTGTCAGACAACCACCGACATCTCGAGATGTCGGTGGTTGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-543s21c1
Sequence:CCGGTGTCGGCTGAGCAGATCAAGGCTCGAGCCTTGATCTGCTCAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-637s21c1
Sequence:CCGGCATGAGCCTGCTGGGTATCAACTCGAGTTGATACCCAGCAGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138705
CALML6 MISSION shRNA shRNA Plasmid DNA
calmodulin-like 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-404s1c1
Sequence:CCGGCCTGGCACTAATGGGAGTTTACTCGAGTAAACTCCCATTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-512s1c1
Sequence:CCGGCACACTCAAGTACGTGCTAATCTCGAGATTAGCACGTACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-395s1c1
Sequence:CCGGCGATGGTTTCCTGGCACTAATCTCGAGATTAGTGCCAGGAAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-236s1c1
Sequence:CCGGCAAGGGAGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-368s1c1
Sequence:CCGGCAGAGACAACAAAGGGTTCTTCTCGAGAAGAACCCTTTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-511s21c1
Sequence:CCGGCTGTCAGACAACCACCGACATCTCGAGATGTCGGTGGTTGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-543s21c1
Sequence:CCGGTGTCGGCTGAGCAGATCAAGGCTCGAGCCTTGATCTGCTCAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-637s21c1
Sequence:CCGGCATGAGCCTGCTGGGTATCAACTCGAGTTGATACCCAGCAGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138705
CALML6 MISSION shRNA Lentiviral Transduction Particles
calmodulin-like 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-404s1c1
Sequence:CCGGCCTGGCACTAATGGGAGTTTACTCGAGTAAACTCCCATTAGTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-512s1c1
Sequence:CCGGCACACTCAAGTACGTGCTAATCTCGAGATTAGCACGTACTTGAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-395s1c1
Sequence:CCGGCGATGGTTTCCTGGCACTAATCTCGAGATTAGTGCCAGGAAACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-236s1c1
Sequence:CCGGCAAGGGAGTCTTTGAGATGTTCTCGAGAACATCTCAAAGACTCCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055714    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138705.1-368s1c1
Sequence:CCGGCAGAGACAACAAAGGGTTCTTCTCGAGAAGAACCCTTTGTTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-511s21c1
Sequence:CCGGCTGTCAGACAACCACCGACATCTCGAGATGTCGGTGGTTGTCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-543s21c1
Sequence:CCGGTGTCGGCTGAGCAGATCAAGGCTCGAGCCTTGATCTGCTCAGCCGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138705.2-637s21c1
Sequence:CCGGCATGAGCCTGCTGGGTATCAACTCGAGTTGATACCCAGCAGGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks