EMAIL THIS PAGE TO A FRIEND

CALN1

calneuron 1

150 Gene Product Result for
Synonyms: CABP8
UniProtKB ID: Q9BXU9, J3KQA7
Gene ID:
Human(83698) Summary: This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Mouse(140904) calneuron 1
Rat(363909) calneuron 1
chicken(417479) calneuron 1
cow(538163) calneuron 1
dog(607123) calneuron 1
sheep(101111598) calneuron 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031468 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031468 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031468 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017440 Rosetta Predictions human pricing
NM_031468 Rosetta Predictions human pricing
NM_001077201 Rosetta Predictions rat pricing
NM_021371 Rosetta Predictions mouse pricing
NM_181045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306774 predicted 1461
2 SASI_Hs01_00134000 predicted 1374
3 SASI_Hs01_00134001 predicted 892
4 SASI_Hs01_00134002 predicted 1449
5 SASI_Hs01_00134003 predicted 1434
6 SASI_Hs02_00306775 predicted 1095
7 SASI_Hs01_00134005 predicted 1145
8 SASI_Hs01_00134006 predicted 1301
9 SASI_Hs01_00134007 predicted 1312
10 SASI_Hs02_00306776 predicted 932
11 SASI_Hs01_00134004 predicted 637
12 SASI_Hs01_00134008 predicted 796
13 SASI_Hs01_00134009 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358890 predicted 1450
2 SASI_Hs01_00051024 predicted 1365
3 SASI_Hs01_00051025 predicted 882
4 SASI_Hs01_00051026 predicted 1440
5 SASI_Hs01_00051027 predicted 1426
6 SASI_Hs02_00358891 predicted 1087
7 SASI_Hs01_00051029 predicted 1129
8 SASI_Hs01_00051030 predicted 1286
9 SASI_Hs01_00051031 predicted 1305
10 SASI_Hs02_00358892 predicted 921
11 SASI_Hs01_00051028 predicted 821
12 SASI_Hs01_00051032 predicted 977
13 SASI_Hs01_00051033 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207492 predicted 385
2 SASI_Rn02_00207493 predicted 205
3 SASI_Rn02_00207494 predicted 384
4 SASI_Rn02_00207495 predicted 200
5 SASI_Rn02_00207496 predicted 197
6 SASI_Rn02_00207497 predicted 379
7 SASI_Rn02_00207498 predicted 481
8 SASI_Rn02_00207499 predicted 252
9 SASI_Rn02_00207500 predicted 194
10 SASI_Rn02_00207501 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074779 predicted 1728
2 SASI_Mm01_00074780 predicted 1119
3 SASI_Mm01_00074781 predicted 1597
4 SASI_Mm01_00074783 predicted 1031
5 SASI_Mm01_00074784 predicted 1791
6 SASI_Mm01_00074785 predicted 1446
7 SASI_Mm01_00074787 predicted 902
8 SASI_Mm02_00325960 predicted 1715
9 SASI_Mm01_00074788 predicted 1490
10 SASI_Mm02_00325961 predicted 1736
11 SASI_Mm01_00074782 predicted 1190
12 SASI_Mm01_00074786 predicted 1573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349609 predicted 1429
2 SASI_Mm02_00349610 predicted 813
3 SASI_Mm02_00349611 predicted 1299
4 SASI_Mm02_00349612 predicted 725
5 SASI_Mm02_00349613 predicted 1485
6 SASI_Mm02_00349614 predicted 1137
7 SASI_Mm02_00349615 predicted 601
8 SASI_Mm02_00349616 predicted 1415
9 SASI_Mm02_00349617 predicted 1193
10 SASI_Mm02_00349618 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031468
CALN1 MISSION shRNA Bacterial Glycerol Stock
calneuron 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1258s21c1
Sequence:CCGGGACACGGACCTATGGACTATGCTCGAGCATAGTCCATAGGTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1290s21c1
Sequence:CCGGACGATGGAACCGTTCAGTAAACTCGAGTTTACTGAACGGTTCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-686s1c1
Sequence:CCGGCCACCTAACGATGAAGGACATCTCGAGATGTCCTTCATCGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-651s1c1
Sequence:CCGGGAGTTGAAGCACATTCTCTATCTCGAGATAGAGAATGTGCTTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-766s1c1
Sequence:CCGGCAGAGTTTGAAGGAGTGCATTCTCGAGAATGCACTCCTTCAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-621s1c1
Sequence:CCGGCAGTTTGACATGCAAAGGATACTCGAGTATCCTTTGCATGTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-555s1c1
Sequence:CCGGCCCAAACTGGTGTCTTCAGAACTCGAGTTCTGAAGACACCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031468
CALN1 MISSION shRNA shRNA Plasmid DNA
calneuron 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1258s21c1
Sequence:CCGGGACACGGACCTATGGACTATGCTCGAGCATAGTCCATAGGTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1290s21c1
Sequence:CCGGACGATGGAACCGTTCAGTAAACTCGAGTTTACTGAACGGTTCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-686s1c1
Sequence:CCGGCCACCTAACGATGAAGGACATCTCGAGATGTCCTTCATCGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-651s1c1
Sequence:CCGGGAGTTGAAGCACATTCTCTATCTCGAGATAGAGAATGTGCTTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-766s1c1
Sequence:CCGGCAGAGTTTGAAGGAGTGCATTCTCGAGAATGCACTCCTTCAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-621s1c1
Sequence:CCGGCAGTTTGACATGCAAAGGATACTCGAGTATCCTTTGCATGTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-555s1c1
Sequence:CCGGCCCAAACTGGTGTCTTCAGAACTCGAGTTCTGAAGACACCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031468
CALN1 MISSION shRNA Lentiviral Transduction Particles
calneuron 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1258s21c1
Sequence:CCGGGACACGGACCTATGGACTATGCTCGAGCATAGTCCATAGGTCCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031468.3-1290s21c1
Sequence:CCGGACGATGGAACCGTTCAGTAAACTCGAGTTTACTGAACGGTTCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-686s1c1
Sequence:CCGGCCACCTAACGATGAAGGACATCTCGAGATGTCCTTCATCGTTAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-651s1c1
Sequence:CCGGGAGTTGAAGCACATTCTCTATCTCGAGATAGAGAATGTGCTTCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-766s1c1
Sequence:CCGGCAGAGTTTGAAGGAGTGCATTCTCGAGAATGCACTCCTTCAAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-621s1c1
Sequence:CCGGCAGTTTGACATGCAAAGGATACTCGAGTATCCTTTGCATGTCAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031468.1-555s1c1
Sequence:CCGGCCCAAACTGGTGTCTTCAGAACTCGAGTTCTGAAGACACCAGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021371
CALN1 MISSION shRNA Bacterial Glycerol Stock
calneuron 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021371.1-1779s1c1
Sequence:CCGGGCTGAAGTTGACTTCTGGGTTCTCGAGAACCCAGAAGTCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1097s1c1
Sequence:CCGGCCGGGATCACTTAACGATGAACTCGAGTTCATCGTTAAGTGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-756s1c1
Sequence:CCGGGCTAATATCTCCGTGGAAGAACTCGAGTTCTTCCACGGAGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-948s1c1
Sequence:CCGGGATGAATTCATGACGATTCTTCTCGAGAAGAATCGTCATGAATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1179s1c1
Sequence:CCGGCAGACAGAGTTTGAAGGAGTTCTCGAGAACTCCTTCAAACTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021371
CALN1 MISSION shRNA shRNA Plasmid DNA
calneuron 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021371.1-1779s1c1
Sequence:CCGGGCTGAAGTTGACTTCTGGGTTCTCGAGAACCCAGAAGTCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1097s1c1
Sequence:CCGGCCGGGATCACTTAACGATGAACTCGAGTTCATCGTTAAGTGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-756s1c1
Sequence:CCGGGCTAATATCTCCGTGGAAGAACTCGAGTTCTTCCACGGAGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-948s1c1
Sequence:CCGGGATGAATTCATGACGATTCTTCTCGAGAAGAATCGTCATGAATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1179s1c1
Sequence:CCGGCAGACAGAGTTTGAAGGAGTTCTCGAGAACTCCTTCAAACTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021371
CALN1 MISSION shRNA Lentiviral Transduction Particles
calneuron 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097840    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021371.1-1779s1c1
Sequence:CCGGGCTGAAGTTGACTTCTGGGTTCTCGAGAACCCAGAAGTCAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1097s1c1
Sequence:CCGGCCGGGATCACTTAACGATGAACTCGAGTTCATCGTTAAGTGATCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-756s1c1
Sequence:CCGGGCTAATATCTCCGTGGAAGAACTCGAGTTCTTCCACGGAGATATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-948s1c1
Sequence:CCGGGATGAATTCATGACGATTCTTCTCGAGAAGAATCGTCATGAATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021371.1-1179s1c1
Sequence:CCGGCAGACAGAGTTTGAAGGAGTTCTCGAGAACTCCTTCAAACTCTGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks