EMAIL THIS PAGE TO A FRIEND

CALR3

calreticulin 3

73 Gene Product Result for
Synonyms: CMH19 CRT2 CT93
UniProtKB ID: Q96L12, D9N574, Q96LN3
Gene ID:
Human(125972) Summary: The protein encoded by this gene belongs to the calreticulin family, members of which are calcium-binding chaperones localized mainly in the endoplasmic reticulum. This protein is also localized to the endoplasmic reticulum lumen, however, its capacity for calcium-binding may be absent or much lower than other family members. This gene is specifically expressed in the testis, and may be required for sperm fertility. Mutation in this gene has been associated with familial hypertrophic cardiomyopathy. [provided by RefSeq, Dec 2011]
Mouse(73316) calreticulin 3
Rat(364529) calreticulin 3
sheep(101115872) calreticulin 3
naked mole-rat(101701992) calreticulin 3
chicken(420146) calreticulin 3
cow(508555) calreticulin 3
domestic cat(101100949) calreticulin 3
dog(476680) calreticulin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029782 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029782 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029782 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120151 MISSION® esiRNA esiRNA human CALR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145046 Rosetta Predictions human pricing
NM_001012212 Rosetta Predictions rat pricing
XM_573877 Rosetta Predictions rat pricing
NM_028500 Rosetta Predictions mouse pricing
NM_029782 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181902 predicted 547
2 SASI_Hs01_00181903 predicted 233
3 SASI_Hs01_00181904 predicted 209
4 SASI_Hs01_00181905 predicted 458
5 SASI_Hs01_00181906 predicted 469
6 SASI_Hs01_00181907 predicted 596
7 SASI_Hs01_00181908 predicted 851
8 SASI_Hs01_00181909 predicted 853
9 SASI_Hs01_00181910 predicted 888
10 SASI_Hs01_00181911 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200457 predicted 616
2 SASI_Rn01_00089217 predicted 349
3 SASI_Rn01_00089218 predicted 587
4 SASI_Rn01_00089219 predicted 418
5 SASI_Rn01_00089220 predicted 1091
6 SASI_Rn01_00089222 predicted 667
7 SASI_Rn01_00089223 predicted 578
8 SASI_Rn01_00089224 predicted 431
9 SASI_Rn01_00089225 predicted 558
10 SASI_Rn02_00200458 predicted 777
11 SASI_Rn01_00089221 predicted 710
12 SASI_Rn01_00089226 predicted 696
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174053 predicted 347
2 SASI_Rn01_00174054 predicted 590
3 SASI_Rn01_00174055 predicted 589
4 SASI_Rn01_00174056 predicted 728
5 SASI_Rn01_00174057 predicted 397
6 SASI_Rn01_00174058 predicted 425
7 SASI_Rn01_00174059 predicted 713
8 SASI_Rn01_00174060 predicted 320
9 SASI_Rn01_00174061 predicted 512
10 SASI_Rn01_00174062 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333973 predicted 747
2 SASI_Mm01_00073546 predicted 942
3 SASI_Mm01_00073547 predicted 933
4 SASI_Mm01_00073548 predicted 899
5 SASI_Mm01_00073549 predicted 811
6 SASI_Mm01_00073550 predicted 807
7 SASI_Mm01_00073552 predicted 864
8 SASI_Mm01_00073553 predicted 876
9 SASI_Mm01_00073555 predicted 935
10 SASI_Mm02_00333974 predicted 929
11 SASI_Mm01_00073551 predicted 923
12 SASI_Mm01_00073554 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029782 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335928 predicted 447
2 SASI_Mm01_00103354 predicted 641
3 SASI_Mm01_00103355 predicted 625
4 SASI_Mm01_00103356 predicted 601
5 SASI_Mm01_00103357 predicted 513
6 SASI_Mm01_00103358 predicted 510
7 SASI_Mm01_00103360 predicted 565
8 SASI_Mm01_00103361 predicted 577
9 SASI_Mm01_00103363 predicted 633
10 SASI_Mm02_00335929 predicted 631
11 SASI_Mm01_00103359 predicted 624
12 SASI_Mm01_00103362 predicted 551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145046
CALR3 MISSION shRNA Bacterial Glycerol Stock
calreticulin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-650s21c1
Sequence:CCGGTAGAGTACGACTGGAACTTAACTCGAGTTAAGTTCCAGTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-1176s21c1
Sequence:CCGGCGAACATTACTTCAATCAATTCTCGAGAATTGATTGAAGTAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-464s1c1
Sequence:CCGGCCGATATTTGTGGATTTGATACTCGAGTATCAAATCCACAAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-123s1c1
Sequence:CCGGCGTCTATTTCCAAGAGGAATTCTCGAGAATTCCTCTTGGAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-888s1c1
Sequence:CCGGGCTCCACCGTAAGATGAAGAACTCGAGTTCTTCATCTTACGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-933s1c1
Sequence:CCGGCCTCTCAGAATTTGAGAACATCTCGAGATGTTCTCAAATTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-310s1c1
Sequence:CCGGCCGTTCAGCAATAAAGGGAAACTCGAGTTTCCCTTTATTGCTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145046
CALR3 MISSION shRNA shRNA Plasmid DNA
calreticulin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-650s21c1
Sequence:CCGGTAGAGTACGACTGGAACTTAACTCGAGTTAAGTTCCAGTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-1176s21c1
Sequence:CCGGCGAACATTACTTCAATCAATTCTCGAGAATTGATTGAAGTAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-464s1c1
Sequence:CCGGCCGATATTTGTGGATTTGATACTCGAGTATCAAATCCACAAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-123s1c1
Sequence:CCGGCGTCTATTTCCAAGAGGAATTCTCGAGAATTCCTCTTGGAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-888s1c1
Sequence:CCGGGCTCCACCGTAAGATGAAGAACTCGAGTTCTTCATCTTACGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-933s1c1
Sequence:CCGGCCTCTCAGAATTTGAGAACATCTCGAGATGTTCTCAAATTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-310s1c1
Sequence:CCGGCCGTTCAGCAATAAAGGGAAACTCGAGTTTCCCTTTATTGCTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145046
CALR3 MISSION shRNA Lentiviral Transduction Particles
calreticulin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-650s21c1
Sequence:CCGGTAGAGTACGACTGGAACTTAACTCGAGTTAAGTTCCAGTCGTACTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145046.3-1176s21c1
Sequence:CCGGCGAACATTACTTCAATCAATTCTCGAGAATTGATTGAAGTAATGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-464s1c1
Sequence:CCGGCCGATATTTGTGGATTTGATACTCGAGTATCAAATCCACAAATATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-123s1c1
Sequence:CCGGCGTCTATTTCCAAGAGGAATTCTCGAGAATTCCTCTTGGAAATAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-888s1c1
Sequence:CCGGGCTCCACCGTAAGATGAAGAACTCGAGTTCTTCATCTTACGGTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-933s1c1
Sequence:CCGGCCTCTCAGAATTTGAGAACATCTCGAGATGTTCTCAAATTCTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145046.2-310s1c1
Sequence:CCGGCCGTTCAGCAATAAAGGGAAACTCGAGTTTCCCTTTATTGCTGAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029782
CALR3 MISSION shRNA Bacterial Glycerol Stock
calreticulin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029782.2-1091s1c1
Sequence:CCGGCCCAGGGTCTGCAATAAGTTTCTCGAGAAACTTATTGCAGACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-183s1c1
Sequence:CCGGCAGGATGCTTAGGACCTGATACTCGAGTATCAGGTCCTAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-304s1c1
Sequence:CCGGGCATCTCTACACCCTGATCTTCTCGAGAAGATCAGGGTGTAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-898s1c1
Sequence:CCGGGCACAACCATTTCAGCAGATTCTCGAGAATCTGCTGAAATGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029782
CALR3 MISSION shRNA shRNA Plasmid DNA
calreticulin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029782.2-1091s1c1
Sequence:CCGGCCCAGGGTCTGCAATAAGTTTCTCGAGAAACTTATTGCAGACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-183s1c1
Sequence:CCGGCAGGATGCTTAGGACCTGATACTCGAGTATCAGGTCCTAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-304s1c1
Sequence:CCGGGCATCTCTACACCCTGATCTTCTCGAGAAGATCAGGGTGTAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-898s1c1
Sequence:CCGGGCACAACCATTTCAGCAGATTCTCGAGAATCTGCTGAAATGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029782
CALR3 MISSION shRNA Lentiviral Transduction Particles
calreticulin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120577    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029782.2-1091s1c1
Sequence:CCGGCCCAGGGTCTGCAATAAGTTTCTCGAGAAACTTATTGCAGACCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-183s1c1
Sequence:CCGGCAGGATGCTTAGGACCTGATACTCGAGTATCAGGTCCTAAGCATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-304s1c1
Sequence:CCGGGCATCTCTACACCCTGATCTTCTCGAGAAGATCAGGGTGTAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029782.2-898s1c1
Sequence:CCGGGCACAACCATTTCAGCAGATTCTCGAGAATCTGCTGAAATGGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks