EMAIL THIS PAGE TO A FRIEND

CALR

calreticulin

91 Gene Product Result for
Synonyms: CRT RO SSA cC1qR
UniProtKB ID: P27797, Q6IAT4, Q9UDG2
Gene ID:
Human(811) Summary: Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
Mouse(12317) calreticulin
Rat(64202) calreticulin
Zebrafish(30248) calreticulin
Zebrafish(100332662) calreticulin
cow(281036) calreticulin
dog(476694) calreticulin
sheep(101104396) calreticulin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV30114 Anti-CALR (AB1) antibody produced in rabbit affinity isolated antibody human, pig, goat, guinea pig, horse, rat, mouse, canine, rabbit, zebrafish
western blot pricing
AV30113 Anti-CALR (AB2) antibody produced in rabbit IgG fraction of antiserum yeast, human, rat, guinea pig, canine, zebrafish, bovine, mouse, horse
western blot pricing
HPA002242 Anti-CALR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4503222 Anti-CALR, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
GW22432F Anti-Calreticulin antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunocytochemistry, western blot pricing
C4606 Anti-Calreticulin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution canine, human
immunofluorescence, immunoprecipitation, microarray, western blot pricing
WH0000811M1 Monoclonal Anti-CALR antibody produced in mouse clone 1G11-1A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300527 Monoclonal Anti-CALR antibody produced in mouse clone 1G6A7, ascites fluid human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C7492 Monoclonal Anti-Calreticulin antibody produced in mouse clone TO-11, tissue culture supernatant, buffered aqueous solution human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0835 AQUA Peptide HEQNID(CAM)GGGYV[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004343 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004343 Rosetta Predictions human pricing
NM_022399 Rosetta Predictions rat pricing
NM_007591 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337402 predicted 968
2 SASI_Hs01_00137572 predicted 953
3 SASI_Hs02_00337403 predicted 952
4 SASI_Hs01_00137578 predicted 547
5 SASI_Hs02_00337404 predicted 210
6 SASI_Hs01_00137580 predicted 928
7 SASI_Hs02_00337405 predicted 384
8 SASI_Hs02_00337406 predicted 967
9 SASI_Hs02_00337407 predicted 407
10 SASI_Hs02_00337408 predicted 867
11 SASI_Hs01_00137571 predicted 488
12 SASI_Hs01_00137573 predicted 583
13 SASI_Hs01_00137574 predicted 565
14 SASI_Hs01_00137575 predicted 981
15 SASI_Hs01_00137576 predicted 305
16 SASI_Hs01_00137577 predicted 522
17 SASI_Hs01_00137579 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022399 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049926 predicted 423
2 SASI_Rn01_00049927 predicted 871
3 SASI_Rn01_00049928 predicted 844
4 SASI_Rn01_00049929 predicted 294
5 SASI_Rn01_00049930 predicted 483
6 SASI_Rn02_00263168 predicted 510
7 SASI_Rn01_00049931 predicted 840
8 SASI_Rn01_00049932 predicted 493
9 SASI_Rn01_00049935 predicted 329
10 SASI_Rn02_00263169 predicted 534
11 SASI_Rn01_00049933 predicted 901
12 SASI_Rn01_00049934 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111520 predicted 947
2 SASI_Mm02_00312005 predicted 644
3 SASI_Mm02_00312006 predicted 1004
4 SASI_Mm01_00111522 predicted 553
5 SASI_Mm01_00111523 predicted 651
6 SASI_Mm01_00111524 predicted 564
7 SASI_Mm02_00312007 predicted 554
8 SASI_Mm01_00111529 predicted 603
9 SASI_Mm02_00312008 predicted 628
10 SASI_Mm02_00312009 predicted 663
11 SASI_Mm01_00111521 predicted 857
12 SASI_Mm01_00111525 predicted 719
13 SASI_Mm01_00111526 predicted 341
14 SASI_Mm01_00111527 predicted 519
15 SASI_Mm01_00111528 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007591
CALR MISSION shRNA Bacterial Glycerol Stock
calreticulin
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1531s1c1
Sequence:CCGGGCCCTCATCTGGTTTCTCATTCTCGAGAATGAGAAACCAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-123s1c1
Sequence:CCGGCCCTGCCATCTATTTCAAAGACTCGAGTCTTTGAAATAGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-552s1c1
Sequence:CCGGCCGGTGTAAGGATGATGAATTCTCGAGAATTCATCATCCTTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-1036s1c1
Sequence:CCGGTCTGGGACAATCTTTGACAATCTCGAGATTGTCAAAGATTGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-507s1c1
Sequence:CCGGCATCTTTAACTACAAGGGCAACTCGAGTTGCCCTTGTAGTTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1823s1c1
Sequence:CCGGGAGTGTAAGAACTACAAACAACTCGAGTTGTTTGTAGTTCTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-976s1c1
Sequence:CCGGGCAAATATCTATGCCTATGATCTCGAGATCATAGGCATAGATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-435s1c1
Sequence:CCGGGCATGGAGACTCAGAATATAACTCGAGTTATATTCTGAGTCTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-176s1c1
Sequence:CCGGGCTGGGTCGAATCCAAACATACTCGAGTATGTTTGGATTCGACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-1101s21c1
Sequence:CCGGCCGGGACAATCTTTGACAATTCTCGAGAATTGTCAAAGATTGTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-281s21c1
Sequence:CCGGGTCCTCAGTTCTGGCAAATTTCTCGAGAAATTTGCCAGAACTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007591
CALR MISSION shRNA shRNA Plasmid DNA
calreticulin
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1531s1c1
Sequence:CCGGGCCCTCATCTGGTTTCTCATTCTCGAGAATGAGAAACCAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-123s1c1
Sequence:CCGGCCCTGCCATCTATTTCAAAGACTCGAGTCTTTGAAATAGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-552s1c1
Sequence:CCGGCCGGTGTAAGGATGATGAATTCTCGAGAATTCATCATCCTTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-1036s1c1
Sequence:CCGGTCTGGGACAATCTTTGACAATCTCGAGATTGTCAAAGATTGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-507s1c1
Sequence:CCGGCATCTTTAACTACAAGGGCAACTCGAGTTGCCCTTGTAGTTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1823s1c1
Sequence:CCGGGAGTGTAAGAACTACAAACAACTCGAGTTGTTTGTAGTTCTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-976s1c1
Sequence:CCGGGCAAATATCTATGCCTATGATCTCGAGATCATAGGCATAGATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-435s1c1
Sequence:CCGGGCATGGAGACTCAGAATATAACTCGAGTTATATTCTGAGTCTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-176s1c1
Sequence:CCGGGCTGGGTCGAATCCAAACATACTCGAGTATGTTTGGATTCGACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-1101s21c1
Sequence:CCGGCCGGGACAATCTTTGACAATTCTCGAGAATTGTCAAAGATTGTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-281s21c1
Sequence:CCGGGTCCTCAGTTCTGGCAAATTTCTCGAGAAATTTGCCAGAACTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007591
CALR MISSION shRNA Lentiviral Transduction Particles
calreticulin
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1531s1c1
Sequence:CCGGGCCCTCATCTGGTTTCTCATTCTCGAGAATGAGAAACCAGATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-123s1c1
Sequence:CCGGCCCTGCCATCTATTTCAAAGACTCGAGTCTTTGAAATAGATGGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-552s1c1
Sequence:CCGGCCGGTGTAAGGATGATGAATTCTCGAGAATTCATCATCCTTACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-1036s1c1
Sequence:CCGGTCTGGGACAATCTTTGACAATCTCGAGATTGTCAAAGATTGTCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-507s1c1
Sequence:CCGGCATCTTTAACTACAAGGGCAACTCGAGTTGCCCTTGTAGTTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007591.2-1823s1c1
Sequence:CCGGGAGTGTAAGAACTACAAACAACTCGAGTTGTTTGTAGTTCTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-976s1c1
Sequence:CCGGGCAAATATCTATGCCTATGATCTCGAGATCATAGGCATAGATATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-435s1c1
Sequence:CCGGGCATGGAGACTCAGAATATAACTCGAGTTATATTCTGAGTCTCCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007591.2-176s1c1
Sequence:CCGGGCTGGGTCGAATCCAAACATACTCGAGTATGTTTGGATTCGACCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-1101s21c1
Sequence:CCGGCCGGGACAATCTTTGACAATTCTCGAGAATTGTCAAAGATTGTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007591.3-281s21c1
Sequence:CCGGGTCCTCAGTTCTGGCAAATTTCTCGAGAAATTTGCCAGAACTGAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004343
VALIDATED
CALR MISSION shRNA Bacterial Glycerol Stock
calreticulin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-976s1c1
Sequence:CCGGCCAGTATCTATGCCTATGATACTCGAGTATCATAGGCATAGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004343.2-678s1c1
Sequence:CCGGCCACCCAAGAAGATAAAGGATCTCGAGATCCTTTATCTTCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-245s1c1
Sequence:CCGGCGAGGAGAAAGATAAAGGTTTCTCGAGAAACCTTTATCTTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-128s1c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-434s1c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-446s21c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-140s21c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-355s21c1
Sequence:CCGGTGGTGCAGTTCACGGTGAAACCTCGAGGTTTCACCGTGAACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-979s21c1
Sequence:CCGGCTCCCGATCCCAGTATCTATGCTCGAGCATAGATACTGGGATCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004343
VALIDATED
CALR MISSION shRNA shRNA Plasmid DNA
calreticulin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-976s1c1
Sequence:CCGGCCAGTATCTATGCCTATGATACTCGAGTATCATAGGCATAGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004343.2-678s1c1
Sequence:CCGGCCACCCAAGAAGATAAAGGATCTCGAGATCCTTTATCTTCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-245s1c1
Sequence:CCGGCGAGGAGAAAGATAAAGGTTTCTCGAGAAACCTTTATCTTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-128s1c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-434s1c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-446s21c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-140s21c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-355s21c1
Sequence:CCGGTGGTGCAGTTCACGGTGAAACCTCGAGGTTTCACCGTGAACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-979s21c1
Sequence:CCGGCTCCCGATCCCAGTATCTATGCTCGAGCATAGATACTGGGATCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004343
VALIDATED
CALR MISSION shRNA Lentiviral Transduction Particles
calreticulin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-976s1c1
Sequence:CCGGCCAGTATCTATGCCTATGATACTCGAGTATCATAGGCATAGATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004343.2-678s1c1
Sequence:CCGGCCACCCAAGAAGATAAAGGATCTCGAGATCCTTTATCTTCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-245s1c1
Sequence:CCGGCGAGGAGAAAGATAAAGGTTTCTCGAGAAACCTTTATCTTTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-128s1c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004343.2-434s1c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-446s21c1
Sequence:CCGGGCACGGAGACTCAGAATACAACTCGAGTTGTATTCTGAGTCTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-140s21c1
Sequence:CCGGCGTCTACTTCAAGGAGCAGTTCTCGAGAACTGCTCCTTGAAGTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-355s21c1
Sequence:CCGGTGGTGCAGTTCACGGTGAAACCTCGAGGTTTCACCGTGAACTGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004343.3-979s21c1
Sequence:CCGGCTCCCGATCCCAGTATCTATGCTCGAGCATAGATACTGGGATCGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks