EMAIL THIS PAGE TO A FRIEND

CALU

calumenin

278 Gene Product Result for
Gene ID:
Human(813) Summary: The product of this gene is a calcium-binding protein localized in the endoplasmic reticulum (ER) and it is involved in such ER functions as protein folding and sorting. This protein belongs to a family of multiple EF-hand proteins (CERC) that include reticulocalbin, ERC-55, and Cab45 and the product of this gene. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
Mouse(12321) calumenin
Rat(64366) calumenin
sheep(101111450) calumenin
cow(539218) calumenin
Horse(100056849) calumenin
dog(475201) calumenin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0905 AQUA Peptide SFDQLTPEES[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001219 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU009801 MISSION® esiRNA esiRNA targeting mouse Calu (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001219 Rosetta Predictions human pricing
NM_001033898 Rosetta Predictions rat pricing
NM_022535 Rosetta Predictions rat pricing
NM_007594 Rosetta Predictions mouse pricing
NM_184053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331373 predicted 369
2 SASI_Hs01_00045119 predicted 845
3 SASI_Hs02_00331374 predicted 978
4 SASI_Hs01_00045120 predicted 721
5 SASI_Hs01_00045121 predicted 709
6 SASI_Hs01_00045122 predicted 430
7 SASI_Hs01_00045123 predicted 489
8 SASI_Hs01_00045125 predicted 601
9 SASI_Hs01_00045126 predicted 923
10 SASI_Hs01_00045127 predicted 657
11 SASI_Hs01_00045124 predicted 650
12 SASI_Hs01_00045128 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203798 predicted 741
2 SASI_Rn02_00203799 predicted 1072
3 SASI_Rn02_00203800 predicted 1030
4 SASI_Rn02_00203801 predicted 1068
5 SASI_Rn02_00203802 predicted 1004
6 SASI_Rn02_00203803 predicted 806
7 SASI_Rn01_00062189 predicted 898
8 SASI_Rn02_00203804 predicted 1108
9 SASI_Rn01_00062190 predicted 910
10 SASI_Rn02_00203805 predicted 916
11 SASI_Rn01_00062183 predicted 509
12 SASI_Rn01_00062184 predicted 447
13 SASI_Rn01_00062185 predicted 360
14 SASI_Rn01_00062186 predicted 530
15 SASI_Rn01_00062187 predicted 286
16 SASI_Rn01_00062188 predicted 150
17 SASI_Rn01_00062191 predicted 476
18 SASI_Rn01_00062192 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022535 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263288 predicted 748
2 SASI_Rn02_00263289 predicted 1071
3 SASI_Rn02_00263290 predicted 1033
4 SASI_Rn02_00263291 predicted 1063
5 SASI_Rn02_00263292 predicted 997
6 SASI_Rn02_00263293 predicted 809
7 SASI_Rn01_00057639 predicted 906
8 SASI_Rn02_00263294 predicted 1103
9 SASI_Rn02_00263295 predicted 905
10 SASI_Rn02_00263296 predicted 911
11 SASI_Rn01_00057632 predicted 463
12 SASI_Rn01_00057633 predicted 373
13 SASI_Rn01_00057634 predicted 305
14 SASI_Rn01_00057635 predicted 490
15 SASI_Rn01_00057636 predicted 169
16 SASI_Rn01_00057637 predicted 518
17 SASI_Rn01_00057638 predicted 716
18 SASI_Rn01_00057640 predicted 549
19 SASI_Rn01_00057641 predicted 183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312021 predicted 1053
2 SASI_Mm02_00312022 predicted 1263
3 SASI_Mm02_00312023 predicted 1357
4 SASI_Mm02_00312024 predicted 1394
5 SASI_Mm02_00312025 predicted 1280
6 SASI_Mm02_00312026 predicted 750
7 SASI_Mm01_00097573 predicted 706
8 SASI_Mm02_00312027 predicted 1235
9 SASI_Mm02_00312028 predicted 909
10 SASI_Mm01_00097578 predicted 957
11 SASI_Mm01_00097572 predicted 679
12 SASI_Mm01_00097574 predicted 618
13 SASI_Mm01_00097575 predicted 501
14 SASI_Mm01_00097576 predicted 441
15 SASI_Mm01_00097577 predicted 887
16 SASI_Mm01_00097579 predicted 322
17 SASI_Mm01_00097580 predicted 375
18 SASI_Mm01_00097581 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_184053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00189909 predicted 701
2 SASI_Mm02_00350552 predicted 193
3 SASI_Mm02_00350553 predicted 377
4 SASI_Mm02_00350554 predicted 709
5 SASI_Mm01_00189911 predicted 642
6 SASI_Mm01_00189914 predicted 525
7 SASI_Mm02_00350555 predicted 911
8 SASI_Mm01_00189915 predicted 957
9 SASI_Mm01_00189916 predicted 482
10 SASI_Mm02_00350556 predicted 1016
11 SASI_Mm01_00189910 predicted 690
12 SASI_Mm01_00189912 predicted 852
13 SASI_Mm01_00189913 predicted 436
14 SASI_Mm01_00189917 predicted 812
15 SASI_Mm01_00189918 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007594
VALIDATED
CALU MISSION shRNA Bacterial Glycerol Stock
calumenin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-965s21c1
Sequence:CCGGTTGTCGACAAGTATGATTTATCTCGAGATAAATCATACTTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-807s21c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007594.3-465s21c1
Sequence:CCGGCGTTTCCTGGGAGGAGTATAACTCGAGTTATACTCCTCCCAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-1359s21c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-195s21c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-1333s1c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-887s1c1
Sequence:CCGGCTGGTCTATGAGTCAGACCAACTCGAGTTGGTCTGACTCATAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-169s1c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-781s1c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-170s1c1
Sequence:CCGGCTCAGCGATAAAGTTCACAATCTCGAGATTGTGAACTTTATCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007594
VALIDATED
CALU MISSION shRNA shRNA Plasmid DNA
calumenin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-965s21c1
Sequence:CCGGTTGTCGACAAGTATGATTTATCTCGAGATAAATCATACTTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-807s21c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007594.3-465s21c1
Sequence:CCGGCGTTTCCTGGGAGGAGTATAACTCGAGTTATACTCCTCCCAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-1359s21c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-195s21c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-1333s1c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-887s1c1
Sequence:CCGGCTGGTCTATGAGTCAGACCAACTCGAGTTGGTCTGACTCATAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-169s1c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-781s1c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-170s1c1
Sequence:CCGGCTCAGCGATAAAGTTCACAATCTCGAGATTGTGAACTTTATCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007594
VALIDATED
CALU MISSION shRNA Lentiviral Transduction Particles
calumenin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-965s21c1
Sequence:CCGGTTGTCGACAAGTATGATTTATCTCGAGATAAATCATACTTGTCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-807s21c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007594.3-465s21c1
Sequence:CCGGCGTTTCCTGGGAGGAGTATAACTCGAGTTATACTCCTCCCAGGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328979    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-1359s21c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007594.3-195s21c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-1333s1c1
Sequence:CCGGCCACACTTGTAGGCAGATATTCTCGAGAATATCTGCCTACAAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-887s1c1
Sequence:CCGGCTGGTCTATGAGTCAGACCAACTCGAGTTGGTCTGACTCATAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-169s1c1
Sequence:CCGGGCTCAGCGATAAAGTTCACAACTCGAGTTGTGAACTTTATCGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-781s1c1
Sequence:CCGGCGTGGAGTTTCGAGATAAGAACTCGAGTTCTTATCTCGAAACTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007594.2-170s1c1
Sequence:CCGGCTCAGCGATAAAGTTCACAATCTCGAGATTGTGAACTTTATCGCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001219
VALIDATED
CALU MISSION shRNA Bacterial Glycerol Stock
calumenin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-612s21c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-202s21c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-1022s21c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-459s21c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-369s1c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-278s1c1
Sequence:CCGGGCTTGGAAAGATTGTAAGTAACTCGAGTTACTTACAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-112s1c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-522s1c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-932s1c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001219
VALIDATED
CALU MISSION shRNA shRNA Plasmid DNA
calumenin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-612s21c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-202s21c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-1022s21c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-459s21c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-369s1c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-278s1c1
Sequence:CCGGGCTTGGAAAGATTGTAAGTAACTCGAGTTACTTACAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-112s1c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-522s1c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-932s1c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001219
VALIDATED
CALU MISSION shRNA Lentiviral Transduction Particles
calumenin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-612s21c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-202s21c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-1022s21c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001219.3-459s21c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-369s1c1
Sequence:CCGGCGCTGGATTTACGAGGATGTACTCGAGTACATCCTCGTAAATCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-278s1c1
Sequence:CCGGGCTTGGAAAGATTGTAAGTAACTCGAGTTACTTACAATCTTTCCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-112s1c1
Sequence:CCGGCCTTGAGCAAACCCACAGAAACTCGAGTTTCTGTGGGTTTGCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-522s1c1
Sequence:CCGGGTTAGAGATGAGCGGAGGTTTCTCGAGAAACCTCCGCTCATCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001219.2-932s1c1
Sequence:CCGGCGTTGACAAGTATGACTTATTCTCGAGAATAAGTCATACTTGTCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks