EMAIL THIS PAGE TO A FRIEND

CALY

calcyon neuron-specific vesicular protein

46 Gene Product Result for
Synonyms: DRD1IP NSG3
UniProtKB ID: Q9NYX4, Q5VWX3, Q5VWY5, Q5VWY6
Gene ID:
Human(50632) Summary: The protein encoded by this gene is a type II single transmembrane protein. It is required for maximal stimulated calcium release after stimulation of purinergic or muscarinic but not beta-adrenergic receptors. The encoded protein interacts with D1 dopamine receptor and may interact with other DA receptor subtypes and/or GPCRs. [provided by RefSeq, Jul 2008]
Mouse(68566) calcyon neuron-specific vesicular protein
Rat(192349) calcyon neuron-specific vesicular protein
Zebrafish(100307104) calcyon neuron-specific vesicular protein
cow(531593) calcyon neuron-specific vesicular protein
dog(491697) calcyon neuron-specific vesicular protein
sheep(101118913) calcyon neuron-specific vesicular protein
naked mole-rat(101699272) calcyon neuron-specific vesicular protein
domestic guinea pig(100726251) calcyon neuron-specific vesicular protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026769 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026769 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026769 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015722 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015722 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015722 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015722 Rosetta Predictions human pricing
NM_138915 Rosetta Predictions rat pricing
NM_026769 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015722 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045249 predicted 407
2 SASI_Hs01_00045251 predicted 443
3 SASI_Hs01_00045252 predicted 395
4 SASI_Hs02_00348411 predicted 397
5 SASI_Hs01_00045253 predicted 397
6 SASI_Hs01_00045254 predicted 413
7 SASI_Hs01_00045255 predicted 403
8 SASI_Hs01_00045256 predicted 444
9 SASI_Hs01_00045257 predicted 438
10 SASI_Hs01_00045258 predicted 403
11 SASI_Hs01_00045250 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138915 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059514 predicted 342
2 SASI_Rn01_00059515 predicted 503
3 SASI_Rn01_00059516 predicted 770
4 SASI_Rn01_00059517 predicted 633
5 SASI_Rn01_00059518 predicted 416
6 SASI_Rn01_00059519 predicted 535
7 SASI_Rn01_00059520 predicted 768
8 SASI_Rn01_00059521 predicted 471
9 SASI_Rn01_00059522 predicted 420
10 SASI_Rn02_00268398 predicted 792
11 SASI_Rn01_00059523 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026769 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116062 predicted 295
2 SASI_Mm01_00116063 predicted 252
3 SASI_Mm02_00330835 predicted 427
4 SASI_Mm01_00116064 predicted 453
5 SASI_Mm01_00116065 predicted 261
6 SASI_Mm01_00116066 predicted 491
7 SASI_Mm01_00116067 predicted 428
8 SASI_Mm01_00116068 predicted 579
9 SASI_Mm01_00116070 predicted 219
10 SASI_Mm01_00116071 predicted 576
11 SASI_Mm01_00116069 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026769
CALY MISSION shRNA Bacterial Glycerol Stock
calcyon neuron-specific vesicular protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-430s1c1
Sequence:CCGGGCCATCTGGTATGACCAGTTTCTCGAGAAACTGGTCATACCAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-726s1c1
Sequence:CCGGGTCTTTGGACACGAGAGAGAACTCGAGTTCTCTCTCGTGTCCAAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-294s1c1
Sequence:CCGGCCAGCCAAAGAAGTTTGCAGACTCGAGTCTGCAAACTTCTTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-263s1c1
Sequence:CCGGCACAGACAGAATATCAACTTACTCGAGTAAGTTGATATTCTGTCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-465s1c1
Sequence:CCGGCTTCCTACTTCGGCACAAGATCTCGAGATCTTGTGCCGAAGTAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-625s21c1
Sequence:CCGGGACCGCCAAGGAGGAGCATAACTCGAGTTATGCTCCTCCTTGGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-506s21c1
Sequence:CCGGATGTACTACACCGAGATGGACCTCGAGGTCCATCTCGGTGTAGTACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026769
CALY MISSION shRNA shRNA Plasmid DNA
calcyon neuron-specific vesicular protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-430s1c1
Sequence:CCGGGCCATCTGGTATGACCAGTTTCTCGAGAAACTGGTCATACCAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-726s1c1
Sequence:CCGGGTCTTTGGACACGAGAGAGAACTCGAGTTCTCTCTCGTGTCCAAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-294s1c1
Sequence:CCGGCCAGCCAAAGAAGTTTGCAGACTCGAGTCTGCAAACTTCTTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-263s1c1
Sequence:CCGGCACAGACAGAATATCAACTTACTCGAGTAAGTTGATATTCTGTCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-465s1c1
Sequence:CCGGCTTCCTACTTCGGCACAAGATCTCGAGATCTTGTGCCGAAGTAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-625s21c1
Sequence:CCGGGACCGCCAAGGAGGAGCATAACTCGAGTTATGCTCCTCCTTGGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-506s21c1
Sequence:CCGGATGTACTACACCGAGATGGACCTCGAGGTCCATCTCGGTGTAGTACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026769
CALY MISSION shRNA Lentiviral Transduction Particles
calcyon neuron-specific vesicular protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-430s1c1
Sequence:CCGGGCCATCTGGTATGACCAGTTTCTCGAGAAACTGGTCATACCAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-726s1c1
Sequence:CCGGGTCTTTGGACACGAGAGAGAACTCGAGTTCTCTCTCGTGTCCAAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-294s1c1
Sequence:CCGGCCAGCCAAAGAAGTTTGCAGACTCGAGTCTGCAAACTTCTTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-263s1c1
Sequence:CCGGCACAGACAGAATATCAACTTACTCGAGTAAGTTGATATTCTGTCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026769.2-465s1c1
Sequence:CCGGCTTCCTACTTCGGCACAAGATCTCGAGATCTTGTGCCGAAGTAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-625s21c1
Sequence:CCGGGACCGCCAAGGAGGAGCATAACTCGAGTTATGCTCCTCCTTGGCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026769.4-506s21c1
Sequence:CCGGATGTACTACACCGAGATGGACCTCGAGGTCCATCTCGGTGTAGTACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015722
CALY MISSION shRNA Bacterial Glycerol Stock
calcyon neuron-specific vesicular protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-235s1c1
Sequence:CCGGTCATCAAGACACAGACAGAATCTCGAGATTCTGTCTGTGTCTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-479s1c1
Sequence:CCGGCCTGGAGATGTACTACACGGACTCGAGTCCGTGTAGTACATCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-163s1c1
Sequence:CCGGCCATGGACAGTGTGCCTCTGACTCGAGTCAGAGGCACACTGTCCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-275s1c1
Sequence:CCGGCCAGCAGAATTTCCCTGACCTCTCGAGAGGTCAGGGAAATTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-386s1c1
Sequence:CCGGCTGCGTGCTGATCATGTACAACTCGAGTTGTACATGATCAGCACGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-520s21c1
Sequence:CCGGACAAGATCTGCACGCCGCTGACTCGAGTCAGCGGCGTGCAGATCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-460s21c1
Sequence:CCGGTCATGTACAAGGCCATCTGGTCTCGAGACCAGATGGCCTTGTACATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-416s21c1
Sequence:CCGGACGGATGATCGCCTTCGCCATCTCGAGATGGCGAAGGCGATCATCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015722
CALY MISSION shRNA shRNA Plasmid DNA
calcyon neuron-specific vesicular protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-235s1c1
Sequence:CCGGTCATCAAGACACAGACAGAATCTCGAGATTCTGTCTGTGTCTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-479s1c1
Sequence:CCGGCCTGGAGATGTACTACACGGACTCGAGTCCGTGTAGTACATCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-163s1c1
Sequence:CCGGCCATGGACAGTGTGCCTCTGACTCGAGTCAGAGGCACACTGTCCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-275s1c1
Sequence:CCGGCCAGCAGAATTTCCCTGACCTCTCGAGAGGTCAGGGAAATTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-386s1c1
Sequence:CCGGCTGCGTGCTGATCATGTACAACTCGAGTTGTACATGATCAGCACGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-520s21c1
Sequence:CCGGACAAGATCTGCACGCCGCTGACTCGAGTCAGCGGCGTGCAGATCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-460s21c1
Sequence:CCGGTCATGTACAAGGCCATCTGGTCTCGAGACCAGATGGCCTTGTACATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-416s21c1
Sequence:CCGGACGGATGATCGCCTTCGCCATCTCGAGATGGCGAAGGCGATCATCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015722
CALY MISSION shRNA Lentiviral Transduction Particles
calcyon neuron-specific vesicular protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-235s1c1
Sequence:CCGGTCATCAAGACACAGACAGAATCTCGAGATTCTGTCTGTGTCTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-479s1c1
Sequence:CCGGCCTGGAGATGTACTACACGGACTCGAGTCCGTGTAGTACATCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-163s1c1
Sequence:CCGGCCATGGACAGTGTGCCTCTGACTCGAGTCAGAGGCACACTGTCCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-275s1c1
Sequence:CCGGCCAGCAGAATTTCCCTGACCTCTCGAGAGGTCAGGGAAATTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015722.2-386s1c1
Sequence:CCGGCTGCGTGCTGATCATGTACAACTCGAGTTGTACATGATCAGCACGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-520s21c1
Sequence:CCGGACAAGATCTGCACGCCGCTGACTCGAGTCAGCGGCGTGCAGATCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-460s21c1
Sequence:CCGGTCATGTACAAGGCCATCTGGTCTCGAGACCAGATGGCCTTGTACATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015722.3-416s21c1
Sequence:CCGGACGGATGATCGCCTTCGCCATCTCGAGATGGCGAAGGCGATCATCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)