EMAIL THIS PAGE TO A FRIEND

CAMK1

calcium/calmodulin-dependent protein kinase I

79 Gene Product Result for
Synonyms: CAMKI
UniProtKB ID: Q14012, Q3KPF6
Gene ID:
Human(8536) Summary: Calcium/calmodulin-dependent protein kinase I is expressed in many tissues and is a component of a calmodulin-dependent protein kinase cascade. Calcium/calmodulin directly activates calcium/calmodulin-dependent protein kinase I by binding to the enzyme and indirectly promotes the phosphorylation and synergistic activation of the enzyme by calcium/calmodulin-dependent protein kinase I kinase. [provided by RefSeq, Jul 2008]
Mouse(52163) calcium/calmodulin-dependent protein kinase I
Rat(171503) calcium/calmodulin-dependent protein kinase I
chicken(416049) calcium/calmodulin-dependent protein kinase I
domestic cat(101084178) calcium/calmodulin-dependent protein kinase I
cow(520498) calcium/calmodulin-dependent protein kinase I
Horse(100052300) calcium/calmodulin-dependent protein kinase I
dog(484665) calcium/calmodulin-dependent protein kinase I
domestic guinea pig(100731166) calcium/calmodulin-dependent protein kinase I
naked mole-rat(101697150) calcium/calmodulin-dependent protein kinase I
sheep(101103762) calcium/calmodulin-dependent protein kinase I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A0591 Autocamtide 2 trifluoroacetate salt ≥97% (HPLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003656 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003656 Rosetta Predictions human pricing
NM_134468 Rosetta Predictions rat pricing
NM_133926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226303 predicted 779
2 SASI_Hs01_00226304 predicted 628
3 SASI_Hs01_00226305 predicted 872
4 SASI_Hs01_00226306 predicted 300
5 SASI_Hs01_00226308 predicted 838
6 SASI_Hs01_00226309 predicted 565
7 SASI_Hs01_00226310 predicted 314
8 SASI_Hs01_00226311 predicted 1007
9 SASI_Hs01_00226312 predicted 206
10 SASI_Hs02_00336033 predicted 813
11 SASI_Hs01_00226307 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041357 predicted 718
2 SASI_Rn01_00041358 predicted 976
3 SASI_Rn01_00041359 predicted 958
4 SASI_Rn01_00041360 predicted 388
5 SASI_Rn01_00041361 predicted 303
6 SASI_Rn01_00041362 predicted 821
7 SASI_Rn01_00041363 predicted 306
8 SASI_Rn01_00041364 predicted 542
9 SASI_Rn01_00041365 predicted 829
10 SASI_Rn01_00041366 predicted 944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045612 predicted 307
2 SASI_Mm01_00045613 predicted 1012
3 SASI_Mm01_00045614 predicted 555
4 SASI_Mm01_00045615 predicted 821
5 SASI_Mm01_00045616 predicted 718
6 SASI_Mm01_00045617 predicted 389
7 SASI_Mm01_00045618 predicted 951
8 SASI_Mm01_00045619 predicted 707
9 SASI_Mm01_00045621 predicted 826
10 SASI_Mm02_00339026 predicted 983
11 SASI_Mm01_00045620 predicted 439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133926
VALIDATED
CAMK1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-157s21c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-309s21c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-865s21c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-790s21c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-157s1c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-309s1c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-865s1c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-790s1c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-992s1c1
Sequence:CCGGCGAGCAGATCAAGAAGAACTTCTCGAGAAGTTCTTCTTGATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133926
VALIDATED
CAMK1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-157s21c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-309s21c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-865s21c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-790s21c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-157s1c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-309s1c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-865s1c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-790s1c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-992s1c1
Sequence:CCGGCGAGCAGATCAAGAAGAACTTCTCGAGAAGTTCTTCTTGATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133926
VALIDATED
CAMK1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-157s21c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-309s21c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-865s21c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133926.2-790s21c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-157s1c1
Sequence:CCGGCGGAAGACATTAGGGATATTTCTCGAGAAATATCCCTAATGTCTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-309s1c1
Sequence:CCGGGAGAACGAGATTGCCGTCTTACTCGAGTAAGACGGCAATCTCGTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-865s1c1
Sequence:CCGGCCAAAGATTTCATACGACATTCTCGAGAATGTCGTATGAAATCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-790s1c1
Sequence:CCGGCCAAACTCTTTGAACAGATTTCTCGAGAAATCTGTTCAAAGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133926.1-992s1c1
Sequence:CCGGCGAGCAGATCAAGAAGAACTTCTCGAGAAGTTCTTCTTGATCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003656
VALIDATED
CAMK1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase I
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-711s1c1
Sequence:CCGGCCTGTGGAACTCCGGGATACGCTCGAGCGTATCCCGGAGTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003656.3-1013s1c1
Sequence:CCGGGATACAGCTCTAGATAAGAATCTCGAGATTCTTATCTAGAGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-816s1c1
Sequence:CCGGGCGGTTACCCTCCCTTCTATGCTCGAGCATAGAAGGGAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-317s1c1
Sequence:CCGGGCCATCAAATGCATTGCCAAGCTCGAGCTTGGCAATGCATTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-289s1c2
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-871s1c1
Sequence:CCGGGAAGGCCGAGTACGAGTTTGACTCGAGTCAAACTCGTACTCGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-553s1c1
Sequence:CCGGGCTGGATGCTGTGAAATACCTCTCGAGAGGTATTTCACAGCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-216s1c1
Sequence:CCGGCGGAGGACATTAGAGACATCTCTCGAGAGATGTCTCTAATGTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1405s1c1
Sequence:CCGGCTACCACTCCTCACTGCATTTCTCGAGAAATGCAGTGAGGAGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1039s1c1
Sequence:CCGGCCAGTCGGTGAGTGAGCAGATCTCGAGATCTGCTCACTCACCGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-214s1c1
Sequence:CCGGGGCGGAGGACATTAGAGACATCTCGAGATGTCTCTAATGTCCTCCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-591s1c1
Sequence:CCGGTACACCGGGATCTCAAGCCAGCTCGAGCTGGCTTGAGATCCCGGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003656.x-289s1c1
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003656
VALIDATED
CAMK1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase I
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-711s1c1
Sequence:CCGGCCTGTGGAACTCCGGGATACGCTCGAGCGTATCCCGGAGTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003656.3-1013s1c1
Sequence:CCGGGATACAGCTCTAGATAAGAATCTCGAGATTCTTATCTAGAGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-816s1c1
Sequence:CCGGGCGGTTACCCTCCCTTCTATGCTCGAGCATAGAAGGGAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-317s1c1
Sequence:CCGGGCCATCAAATGCATTGCCAAGCTCGAGCTTGGCAATGCATTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-289s1c2
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-871s1c1
Sequence:CCGGGAAGGCCGAGTACGAGTTTGACTCGAGTCAAACTCGTACTCGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-553s1c1
Sequence:CCGGGCTGGATGCTGTGAAATACCTCTCGAGAGGTATTTCACAGCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-216s1c1
Sequence:CCGGCGGAGGACATTAGAGACATCTCTCGAGAGATGTCTCTAATGTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1405s1c1
Sequence:CCGGCTACCACTCCTCACTGCATTTCTCGAGAAATGCAGTGAGGAGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1039s1c1
Sequence:CCGGCCAGTCGGTGAGTGAGCAGATCTCGAGATCTGCTCACTCACCGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-214s1c1
Sequence:CCGGGGCGGAGGACATTAGAGACATCTCGAGATGTCTCTAATGTCCTCCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-591s1c1
Sequence:CCGGTACACCGGGATCTCAAGCCAGCTCGAGCTGGCTTGAGATCCCGGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003656.x-289s1c1
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003656
VALIDATED
CAMK1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase I
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-711s1c1
Sequence:CCGGCCTGTGGAACTCCGGGATACGCTCGAGCGTATCCCGGAGTTCCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003656.3-1013s1c1
Sequence:CCGGGATACAGCTCTAGATAAGAATCTCGAGATTCTTATCTAGAGCTGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-816s1c1
Sequence:CCGGGCGGTTACCCTCCCTTCTATGCTCGAGCATAGAAGGGAGGGTAACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003656.3-317s1c1
Sequence:CCGGGCCATCAAATGCATTGCCAAGCTCGAGCTTGGCAATGCATTTGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-289s1c2
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-871s1c1
Sequence:CCGGGAAGGCCGAGTACGAGTTTGACTCGAGTCAAACTCGTACTCGGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-553s1c1
Sequence:CCGGGCTGGATGCTGTGAAATACCTCTCGAGAGGTATTTCACAGCATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-216s1c1
Sequence:CCGGCGGAGGACATTAGAGACATCTCTCGAGAGATGTCTCTAATGTCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1405s1c1
Sequence:CCGGCTACCACTCCTCACTGCATTTCTCGAGAAATGCAGTGAGGAGTGGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-1039s1c1
Sequence:CCGGCCAGTCGGTGAGTGAGCAGATCTCGAGATCTGCTCACTCACCGACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-214s1c1
Sequence:CCGGGGCGGAGGACATTAGAGACATCTCGAGATGTCTCTAATGTCCTCCGCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003656.x-591s1c1
Sequence:CCGGTACACCGGGATCTCAAGCCAGCTCGAGCTGGCTTGAGATCCCGGTGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003656.x-289s1c1
Sequence:CCGGAGAAGATAAGAGGACGCAGAACTCGAGTTCTGCGTCCTCTTATCTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks