EMAIL THIS PAGE TO A FRIEND

CAMK1D

calcium/calmodulin-dependent protein kinase ID

123 Gene Product Result for
Synonyms: CKLiK CaM-K1 CaMKID
UniProtKB ID: Q8IU85, B0YIY0, Q9HD31
Gene ID:
Human(57118) Summary: This gene encodes a member of the Ca2+/calmodulin-dependent protein kinase 1 subfamily of serine/threonine kinases. The encoded protein may be involved in the regulation of granulocyte function through the chemokine signal transduction pathway. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]
Mouse(227541) calcium/calmodulin-dependent protein kinase ID
Rat(307124) calcium/calmodulin-dependent protein kinase ID
sheep(101108939) calcium/calmodulin-dependent protein kinase ID
naked mole-rat(101717828) calcium/calmodulin-dependent protein kinase ID
domestic guinea pig(100724747) calcium/calmodulin-dependent protein kinase ID
chicken(425522) calcium/calmodulin-dependent protein kinase ID
cow(526873) calcium/calmodulin-dependent protein kinase ID
Horse(100056740) calcium/calmodulin-dependent protein kinase ID
domestic cat(101097250) calcium/calmodulin-dependent protein kinase ID
dog(607636) calcium/calmodulin-dependent protein kinase ID
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020397 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020397 Rosetta Predictions human pricing
NM_153498 Rosetta Predictions human pricing
NM_001107365 Rosetta Predictions rat pricing
XM_225567 Rosetta Predictions rat pricing
NM_177343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210693 predicted 776
2 SASI_Hs01_00210694 predicted 787
3 SASI_Hs01_00210695 predicted 690
4 SASI_Hs01_00210696 predicted 620
5 SASI_Hs01_00210697 predicted 1013
6 SASI_Hs01_00210698 predicted 856
7 SASI_Hs02_00353379 predicted 432
8 SASI_Hs01_00210699 predicted 609
9 SASI_Hs01_00210700 predicted 756
10 SASI_Hs01_00210701 predicted 497
11 SASI_Hs01_00210702 predicted 958
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153498 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245682 predicted 770
2 SASI_Hs01_00245683 predicted 780
3 SASI_Hs01_00245684 predicted 691
4 SASI_Hs01_00245685 predicted 624
5 SASI_Hs01_00245686 predicted 1009
6 SASI_Hs01_00245687 predicted 851
7 SASI_Hs02_00367319 predicted 437
8 SASI_Hs01_00245688 predicted 615
9 SASI_Hs01_00245689 predicted 754
10 SASI_Hs01_00245690 predicted 506
11 SASI_Hs01_00245691 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228105 predicted 1550
2 SASI_Rn02_00228106 predicted 354
3 SASI_Rn02_00228107 predicted 1063
4 SASI_Rn02_00228108 predicted 395
5 SASI_Rn02_00228109 predicted 1524
6 SASI_Rn02_00228110 predicted 608
7 SASI_Rn02_00228111 predicted 1076
8 SASI_Rn02_00228112 predicted 1478
9 SASI_Rn02_00228113 predicted 931
10 SASI_Rn02_00228114 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225567 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124312 predicted 267
2 SASI_Rn01_00124313 predicted 207
3 SASI_Rn01_00124314 predicted 1529
4 SASI_Rn01_00124315 predicted 1559
5 SASI_Rn01_00124316 predicted 2051
6 SASI_Rn01_00124317 predicted 500
7 SASI_Rn01_00124318 predicted 659
8 SASI_Rn01_00124319 predicted 1898
9 SASI_Rn01_00124320 predicted 2076
10 SASI_Rn01_00124321 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347473 predicted 883
2 SASI_Mm01_00174809 predicted 630
3 SASI_Mm01_00174810 predicted 818
4 SASI_Mm01_00174811 predicted 573
5 SASI_Mm02_00347474 predicted 628
6 SASI_Mm01_00174813 predicted 698
7 SASI_Mm01_00174814 predicted 1351
8 SASI_Mm01_00174815 predicted 860
9 SASI_Mm01_00174816 predicted 1370
10 SASI_Mm01_00174817 predicted 1574
11 SASI_Mm01_00174812 predicted 1211
12 SASI_Mm01_00174818 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177343
CAMK1D MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase ID
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-717s1c1
Sequence:CCGGGCCGGAGAATCTCTTATACTACTCGAGTAGTATAAGAGATTCTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-973s1c1
Sequence:CCGGCAGATCCTCAAGGCAGAATATCTCGAGATATTCTGCCTTGAGGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-321s1c1
Sequence:CCGGGCAAGCAGAAGACATTAAGAACTCGAGTTCTTAATGTCTTCTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-671s1c1
Sequence:CCGGCCGTATACTATCTCCACAGAACTCGAGTTCTGTGGAGATAGTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-1339s21c1
Sequence:CCGGCAAATGGAGACAAGCGTTTAACTCGAGTTAAACGCTTGTCTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-670s21c1
Sequence:CCGGTGTTGCCTTGGAAGATATTTACTCGAGTAAATATCTTCCAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177343.3-2033s21c1
Sequence:CCGGGTTACATGACCTCTATCATTTCTCGAGAAATGATAGAGGTCATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177343
CAMK1D MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase ID
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-717s1c1
Sequence:CCGGGCCGGAGAATCTCTTATACTACTCGAGTAGTATAAGAGATTCTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-973s1c1
Sequence:CCGGCAGATCCTCAAGGCAGAATATCTCGAGATATTCTGCCTTGAGGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-321s1c1
Sequence:CCGGGCAAGCAGAAGACATTAAGAACTCGAGTTCTTAATGTCTTCTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-671s1c1
Sequence:CCGGCCGTATACTATCTCCACAGAACTCGAGTTCTGTGGAGATAGTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-1339s21c1
Sequence:CCGGCAAATGGAGACAAGCGTTTAACTCGAGTTAAACGCTTGTCTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-670s21c1
Sequence:CCGGTGTTGCCTTGGAAGATATTTACTCGAGTAAATATCTTCCAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177343.3-2033s21c1
Sequence:CCGGGTTACATGACCTCTATCATTTCTCGAGAAATGATAGAGGTCATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177343
CAMK1D MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase ID
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-717s1c1
Sequence:CCGGGCCGGAGAATCTCTTATACTACTCGAGTAGTATAAGAGATTCTCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-973s1c1
Sequence:CCGGCAGATCCTCAAGGCAGAATATCTCGAGATATTCTGCCTTGAGGATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-321s1c1
Sequence:CCGGGCAAGCAGAAGACATTAAGAACTCGAGTTCTTAATGTCTTCTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177343.2-671s1c1
Sequence:CCGGCCGTATACTATCTCCACAGAACTCGAGTTCTGTGGAGATAGTATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-1339s21c1
Sequence:CCGGCAAATGGAGACAAGCGTTTAACTCGAGTTAAACGCTTGTCTCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177343.3-670s21c1
Sequence:CCGGTGTTGCCTTGGAAGATATTTACTCGAGTAAATATCTTCCAAGGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362174    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177343.3-2033s21c1
Sequence:CCGGGTTACATGACCTCTATCATTTCTCGAGAAATGATAGAGGTCATGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020397
VALIDATED
CAMK1D MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase ID
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-234s1c1
Sequence:CCGGTGCTGTGAAGTGTATCCCTAACTCGAGTTAGGGATACACTTCACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-863s1c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-791s1c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-287s1c1
Sequence:CCGGAGAATGAGATAGCCGTCCTGACTCGAGTCAGGACGGCTATCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-446s1c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-856s1c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020397.2-1383s1c1
Sequence:CCGGCTATACTTAATCCCATGTCATCTCGAGATGACATGGGATTAAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-929s1c1
Sequence:CCGGCAGATCCTCAAGGCGGAATATCTCGAGATATTCCGCCTTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-995s1c1
Sequence:CCGGGACTTCATTCGGAACCTGATGCTCGAGCATCAGGTTCCGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-1011s21c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-856s21c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-939s21c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-547s21c1
Sequence:CCGGAGAGCTGTTTGACCGGATAGTCTCGAGACTATCCGGTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-446s21c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020397
VALIDATED
CAMK1D MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase ID
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-234s1c1
Sequence:CCGGTGCTGTGAAGTGTATCCCTAACTCGAGTTAGGGATACACTTCACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-863s1c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-791s1c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-287s1c1
Sequence:CCGGAGAATGAGATAGCCGTCCTGACTCGAGTCAGGACGGCTATCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-446s1c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-856s1c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020397.2-1383s1c1
Sequence:CCGGCTATACTTAATCCCATGTCATCTCGAGATGACATGGGATTAAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-929s1c1
Sequence:CCGGCAGATCCTCAAGGCGGAATATCTCGAGATATTCCGCCTTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-995s1c1
Sequence:CCGGGACTTCATTCGGAACCTGATGCTCGAGCATCAGGTTCCGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-1011s21c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-856s21c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-939s21c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-547s21c1
Sequence:CCGGAGAGCTGTTTGACCGGATAGTCTCGAGACTATCCGGTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-446s21c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020397
VALIDATED
CAMK1D MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase ID
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-234s1c1
Sequence:CCGGTGCTGTGAAGTGTATCCCTAACTCGAGTTAGGGATACACTTCACAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-863s1c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.x-791s1c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.x-287s1c1
Sequence:CCGGAGAATGAGATAGCCGTCCTGACTCGAGTCAGGACGGCTATCTCATTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-446s1c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020397.2-856s1c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020397.2-1383s1c1
Sequence:CCGGCTATACTTAATCCCATGTCATCTCGAGATGACATGGGATTAAGTATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-929s1c1
Sequence:CCGGCAGATCCTCAAGGCGGAATATCTCGAGATATTCCGCCTTGAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_020397.2-995s1c1
Sequence:CCGGGACTTCATTCGGAACCTGATGCTCGAGCATCAGGTTCCGAATGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-1011s21c1
Sequence:CCGGTGATGGAGAAGGACCCGAATACTCGAGTATTCGGGTCCTTCTCCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342579    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-856s21c1
Sequence:CCGGCGGAGTGATTGCCTACATCTTCTCGAGAAGATGTAGGCAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-939s21c1
Sequence:CCGGAGGCGGAATATGAGTTTGACTCTCGAGAGTCAAACTCATATTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-547s21c1
Sequence:CCGGAGAGCTGTTTGACCGGATAGTCTCGAGACTATCCGGTCAAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020397.2-446s21c1
Sequence:CCGGGCCGTCCTGAGAAAGATTAAGCTCGAGCTTAATCTTTCTCAGGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks