EMAIL THIS PAGE TO A FRIEND

CAMK1G

calcium/calmodulin-dependent protein kinase IG

63 Gene Product Result for
Synonyms: CLICK3 CLICKIII VWS1 dJ272L16.1
UniProtKB ID: Q96NX5, Q86UH5, Q9Y3J7
Gene ID:
Human(57172) Summary: This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
Mouse(215303) calcium/calmodulin-dependent protein kinase I gamma
Rat(171358) calcium/calmodulin-dependent protein kinase IG
chicken(419859) calcium/calmodulin-dependent protein kinase IG
cow(511504) calcium/calmodulin-dependent protein kinase IG
Horse(100056611) calcium/calmodulin-dependent protein kinase IG
domestic cat(101089070) calcium/calmodulin-dependent protein kinase IG
dog(490273) calcium/calmodulin-dependent protein kinase IG
domestic guinea pig(100712760) calcium/calmodulin-dependent protein kinase IG
naked mole-rat(101718073) calcium/calmodulin-dependent protein kinase IG
sheep(101105428) calcium/calmodulin-dependent protein kinase IG
Domestic Rabbit(100343158) calcium/calmodulin-dependent protein kinase IG
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020439 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020439 Rosetta Predictions human pricing
NM_182842 Rosetta Predictions rat pricing
NM_144817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244454 predicted 483
2 SASI_Hs01_00244455 predicted 567
3 SASI_Hs01_00244456 predicted 950
4 SASI_Hs01_00244457 predicted 750
5 SASI_Hs02_00353461 predicted 1115
6 SASI_Hs01_00244459 predicted 802
7 SASI_Hs01_00244460 predicted 556
8 SASI_Hs01_00244461 predicted 1384
9 SASI_Hs01_00244462 predicted 1097
10 SASI_Hs01_00244463 predicted 1214
11 SASI_Hs01_00244458 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036100 predicted 547
2 SASI_Rn01_00036101 predicted 465
3 SASI_Rn02_00269855 predicted 828
4 SASI_Rn01_00036102 predicted 926
5 SASI_Rn01_00036103 predicted 779
6 SASI_Rn01_00036104 predicted 857
7 SASI_Rn02_00269856 predicted 682
8 SASI_Rn01_00036106 predicted 862
9 SASI_Rn01_00036107 predicted 586
10 SASI_Rn01_00036109 predicted 1237
11 SASI_Rn01_00036105 predicted 740
12 SASI_Rn01_00036108 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113760 predicted 523
2 SASI_Mm01_00113761 predicted 958
3 SASI_Mm02_00340176 predicted 272
4 SASI_Mm01_00113762 predicted 1655
5 SASI_Mm01_00113763 predicted 984
6 SASI_Mm01_00113764 predicted 795
7 SASI_Mm01_00113765 predicted 837
8 SASI_Mm01_00113766 predicted 744
9 SASI_Mm01_00113767 predicted 643
10 SASI_Mm01_00113768 predicted 434
11 SASI_Mm01_00113769 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144817
CAMK1G MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase IG
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144817.2-2033s21c1
Sequence:CCGGAGACTGGACCCATTATCATAGCTCGAGCTATGATAATGGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-856s21c1
Sequence:CCGGCTCCGTTCTGGGATGACATTTCTCGAGAAATGTCATCCCAGAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-514s21c1
Sequence:CCGGAGGTCTTGTCTGCGGTGAAATCTCGAGATTTCACCGCAGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-1393s21c1
Sequence:CCGGGCTGCTCCAGCTGTCTAAATACTCGAGTATTTAGACAGCTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-1402s1c1
Sequence:CCGGCCTCTTCAGAAAGGCCAATAACTCGAGTTATTGGCCTTTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-121s1c1
Sequence:CCGGGAAGAAACAGACCACCAACATCTCGAGATGTTGGTGGTCTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-229s1c1
Sequence:CCGGCTTTGCTCTGAAATGTATCAACTCGAGTTGATACATTTCAGAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-737s1c1
Sequence:CCGGCCTTTCTATGAAGAAACAGAACTCGAGTTCTGTTTCTTCATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-584s1c1
Sequence:CCGGCTATCCAAGATGGAGCAGAATCTCGAGATTCTGCTCCATCTTGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144817
CAMK1G MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase IG
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144817.2-2033s21c1
Sequence:CCGGAGACTGGACCCATTATCATAGCTCGAGCTATGATAATGGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-856s21c1
Sequence:CCGGCTCCGTTCTGGGATGACATTTCTCGAGAAATGTCATCCCAGAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-514s21c1
Sequence:CCGGAGGTCTTGTCTGCGGTGAAATCTCGAGATTTCACCGCAGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-1393s21c1
Sequence:CCGGGCTGCTCCAGCTGTCTAAATACTCGAGTATTTAGACAGCTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-1402s1c1
Sequence:CCGGCCTCTTCAGAAAGGCCAATAACTCGAGTTATTGGCCTTTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-121s1c1
Sequence:CCGGGAAGAAACAGACCACCAACATCTCGAGATGTTGGTGGTCTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-229s1c1
Sequence:CCGGCTTTGCTCTGAAATGTATCAACTCGAGTTGATACATTTCAGAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-737s1c1
Sequence:CCGGCCTTTCTATGAAGAAACAGAACTCGAGTTCTGTTTCTTCATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-584s1c1
Sequence:CCGGCTATCCAAGATGGAGCAGAATCTCGAGATTCTGCTCCATCTTGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144817
CAMK1G MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase IG
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144817.2-2033s21c1
Sequence:CCGGAGACTGGACCCATTATCATAGCTCGAGCTATGATAATGGGTCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-856s21c1
Sequence:CCGGCTCCGTTCTGGGATGACATTTCTCGAGAAATGTCATCCCAGAACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-514s21c1
Sequence:CCGGAGGTCTTGTCTGCGGTGAAATCTCGAGATTTCACCGCAGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144817.2-1393s21c1
Sequence:CCGGGCTGCTCCAGCTGTCTAAATACTCGAGTATTTAGACAGCTGGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-1402s1c1
Sequence:CCGGCCTCTTCAGAAAGGCCAATAACTCGAGTTATTGGCCTTTCTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-121s1c1
Sequence:CCGGGAAGAAACAGACCACCAACATCTCGAGATGTTGGTGGTCTGTTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-229s1c1
Sequence:CCGGCTTTGCTCTGAAATGTATCAACTCGAGTTGATACATTTCAGAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-737s1c1
Sequence:CCGGCCTTTCTATGAAGAAACAGAACTCGAGTTCTGTTTCTTCATAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144817.1-584s1c1
Sequence:CCGGCTATCCAAGATGGAGCAGAATCTCGAGATTCTGCTCCATCTTGGATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020439
CAMK1G MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase IG
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020439.2-2294s21c1
Sequence:CCGGTAACCTTGGAAGTTGACTATTCTCGAGAATAGTCAACTTCCAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-844s21c1
Sequence:CCGGGAGTCAGCCAAGGACTTTATTCTCGAGAATAAAGTCCTTGGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-760s21c1
Sequence:CCGGTATGAAGAAACGGAGTCTAAGCTCGAGCTTAGACTCCGTTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-717s21c1
Sequence:CCGGCGGCGTCATCACCTACATATTCTCGAGAATATGTAGGTGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-1382s1c1
Sequence:CCGGGCAAAGGAAAGTCCTCCTACTCTCGAGAGTAGGAGGACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2094s1c1
Sequence:CCGGCTTCAAGTTCTAATCCTTAACCTCGAGGTTAAGGATTAGAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-516s1c1
Sequence:CCGGCATCGTCCACAGAGACTTAAACTCGAGTTTAAGTCTCTGTGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2012s1c1
Sequence:CCGGGCCAGATTGGGCTCATTAATGCTCGAGCATTAATGAGCCCAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020439.x-1503s1c1
Sequence:CCGGATATTCAACTCCTCTGCTCTTCTCGAGAAGAGCAGAGGAGTTGAATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-420s1c1
Sequence:CCGGGTGAAATACCTACATGAGAATCTCGAGATTCTCATGTAGGTATTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-905s1c1
Sequence:CCGGCCTCCAGATCCAGAAGAACTTCTCGAGAAGTTCTTCTGGATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-783s1c1
Sequence:CCGGGACTTTATTTGCCACTTGCTTCTCGAGAAGCAAGTGGCAAATAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-716s1c1
Sequence:CCGGGAAGATCAAGGAGGGCTACTACTCGAGTAGTAGCCCTCCTTGATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020439
CAMK1G MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase IG
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020439.2-2294s21c1
Sequence:CCGGTAACCTTGGAAGTTGACTATTCTCGAGAATAGTCAACTTCCAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-844s21c1
Sequence:CCGGGAGTCAGCCAAGGACTTTATTCTCGAGAATAAAGTCCTTGGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-760s21c1
Sequence:CCGGTATGAAGAAACGGAGTCTAAGCTCGAGCTTAGACTCCGTTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-717s21c1
Sequence:CCGGCGGCGTCATCACCTACATATTCTCGAGAATATGTAGGTGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-1382s1c1
Sequence:CCGGGCAAAGGAAAGTCCTCCTACTCTCGAGAGTAGGAGGACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2094s1c1
Sequence:CCGGCTTCAAGTTCTAATCCTTAACCTCGAGGTTAAGGATTAGAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-516s1c1
Sequence:CCGGCATCGTCCACAGAGACTTAAACTCGAGTTTAAGTCTCTGTGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2012s1c1
Sequence:CCGGGCCAGATTGGGCTCATTAATGCTCGAGCATTAATGAGCCCAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020439.x-1503s1c1
Sequence:CCGGATATTCAACTCCTCTGCTCTTCTCGAGAAGAGCAGAGGAGTTGAATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-420s1c1
Sequence:CCGGGTGAAATACCTACATGAGAATCTCGAGATTCTCATGTAGGTATTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-905s1c1
Sequence:CCGGCCTCCAGATCCAGAAGAACTTCTCGAGAAGTTCTTCTGGATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-783s1c1
Sequence:CCGGGACTTTATTTGCCACTTGCTTCTCGAGAAGCAAGTGGCAAATAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-716s1c1
Sequence:CCGGGAAGATCAAGGAGGGCTACTACTCGAGTAGTAGCCCTCCTTGATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020439
CAMK1G MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase IG
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020439.2-2294s21c1
Sequence:CCGGTAACCTTGGAAGTTGACTATTCTCGAGAATAGTCAACTTCCAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-844s21c1
Sequence:CCGGGAGTCAGCCAAGGACTTTATTCTCGAGAATAAAGTCCTTGGCTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-760s21c1
Sequence:CCGGTATGAAGAAACGGAGTCTAAGCTCGAGCTTAGACTCCGTTTCTTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020439.2-717s21c1
Sequence:CCGGCGGCGTCATCACCTACATATTCTCGAGAATATGTAGGTGATGACGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-1382s1c1
Sequence:CCGGGCAAAGGAAAGTCCTCCTACTCTCGAGAGTAGGAGGACTTTCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194858    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2094s1c1
Sequence:CCGGCTTCAAGTTCTAATCCTTAACCTCGAGGTTAAGGATTAGAACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020439.2-516s1c1
Sequence:CCGGCATCGTCCACAGAGACTTAAACTCGAGTTTAAGTCTCTGTGGACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196940    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020439.2-2012s1c1
Sequence:CCGGGCCAGATTGGGCTCATTAATGCTCGAGCATTAATGAGCCCAATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001452    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020439.x-1503s1c1
Sequence:CCGGATATTCAACTCCTCTGCTCTTCTCGAGAAGAGCAGAGGAGTTGAATATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-420s1c1
Sequence:CCGGGTGAAATACCTACATGAGAATCTCGAGATTCTCATGTAGGTATTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-905s1c1
Sequence:CCGGCCTCCAGATCCAGAAGAACTTCTCGAGAAGTTCTTCTGGATCTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-783s1c1
Sequence:CCGGGACTTTATTTGCCACTTGCTTCTCGAGAAGCAAGTGGCAAATAAAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020439.x-716s1c1
Sequence:CCGGGAAGATCAAGGAGGGCTACTACTCGAGTAGTAGCCCTCCTTGATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks