EMAIL THIS PAGE TO A FRIEND

CAMK2A

calcium/calmodulin-dependent protein kinase II alpha

183 Gene Product Result for
Synonyms: CAMKA
UniProtKB ID: Q9UQM7, Q9UL21, Q9Y2H4, Q9Y352
Gene ID:
Human(815) Summary: The product of this gene belongs to the serine/threonine protein kinases family, and to the Ca(2+)/calmodulin-dependent protein kinases subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. This calcium calmodulin-dependent protein kinase is composed of four different chains: alpha, beta, gamma, and delta. The alpha chain encoded by this gene is required for hippocampal long-term potentiation (LTP) and spatial learning. In addition to its calcium-calmodulin (CaM)-dependent activity, this protein can undergo autophosphorylation, resulting in CaM-independent activity. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2008]
Mouse(12322) calcium/calmodulin-dependent protein kinase II alpha
Rat(25400) calcium/calmodulin-dependent protein kinase II alpha
Domestic Rabbit(100341507) calcium/calmodulin-dependent protein kinase II alpha
naked mole-rat(101722229) calcium/calmodulin-dependent protein kinase II alpha
domestic guinea pig(100727059) calcium/calmodulin-dependent protein kinase II alpha
Zebrafish(550436) calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha
chicken(374175) calcium/calmodulin-dependent protein kinase II alpha
dog(612941) calcium/calmodulin-dependent protein kinase II alpha
cow(530719) calcium/calmodulin-dependent protein kinase II alpha
Horse(100071654) calcium/calmodulin-dependent protein kinase II alpha
domestic cat(101084342) calcium/calmodulin-dependent protein kinase II alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C6974 Anti-CaM Kinase IIα (CaMKIIα) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat, chicken
microarray, western blot pricing
SAB4503243 Anti-CAMK2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4503250 Anti-CAMK2 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C5119 Anti-CAMK2A (411-425) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501257 Anti-CAMK2A antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB1405553 Anti-CAMK2A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
P5997 Anti-phospho-CaM Kinase II (CAMKII) (pThr305) antibody produced in rabbit whole antiserum rat
western blot pricing
SAB4300228 Anti-phospho-CAMK2A (pThr286) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
C265 Monoclonal Anti-CaM Kinase IIα (CaMKIIα) antibody produced in mouse clone 6G9, purified immunoglobulin, buffered aqueous solution rat
immunofluorescence, western blot pricing
WH0000815M1 Monoclonal Anti-CAMK2A antibody produced in mouse clone 2C4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1403629 Monoclonal Anti-CAMK2A antibody produced in mouse clone 2C12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
P247 Monoclonal Anti-phospho-CaM Kinase IIα (pThr286) antibody produced in mouse clone 22B1, purified immunoglobulin, buffered aqueous solution mouse, rat
immunofluorescence, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A3281 N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A4308 Autocamtide 2-related inhibitory peptide ≥97% (HPLC), lyophilized powder human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0087 AQUA Peptide DLKPENLLLAS[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing
AQ0133 AQUA Peptide ITQYLDAGGIP[R] dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_171825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_171825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_171825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015981 Rosetta Predictions human pricing
NM_171825 Rosetta Predictions human pricing
NM_012920 Rosetta Predictions rat pricing
NM_009792 Rosetta Predictions mouse pricing
NM_177407 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189888 predicted 391
2 SASI_Hs01_00189889 predicted 1682
3 SASI_Hs01_00189890 predicted 1565
4 SASI_Hs01_00189891 predicted 1707
5 SASI_Hs01_00189892 predicted 1465
6 SASI_Hs01_00189893 predicted 1444
7 SASI_Hs01_00189894 predicted 1431
8 SASI_Hs01_00189895 predicted 1653
9 SASI_Hs01_00189896 predicted 1783
10 SASI_Hs01_00189897 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245732 predicted 389
2 SASI_Hs01_00245733 predicted 1649
3 SASI_Hs01_00245734 predicted 1524
4 SASI_Hs01_00245735 predicted 1666
5 SASI_Hs01_00245736 predicted 1435
6 SASI_Hs01_00245737 predicted 1412
7 SASI_Hs01_00245738 predicted 1399
8 SASI_Hs01_00245739 predicted 1616
9 SASI_Hs01_00245740 predicted 1748
10 SASI_Hs01_00245741 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042212 predicted 220
2 SASI_Rn01_00042213 predicted 1016
3 SASI_Rn01_00042214 predicted 1053
4 SASI_Rn01_00042215 predicted 1061
5 SASI_Rn01_00042216 predicted 223
6 SASI_Rn01_00042217 predicted 1082
7 SASI_Rn01_00042218 predicted 1009
8 SASI_Rn01_00042219 predicted 796
9 SASI_Rn01_00042220 predicted 1069
10 SASI_Rn01_00042221 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317045 predicted 1285
2 SASI_Mm01_00099334 predicted 726
3 SASI_Mm01_00099335 predicted 740
4 SASI_Mm02_00317046 predicted 957
5 SASI_Mm02_00317047 predicted 1019
6 SASI_Mm02_00317048 predicted 837
7 SASI_Mm01_00099339 predicted 707
8 SASI_Mm02_00317049 predicted 1375
9 SASI_Mm02_00317050 predicted 1272
10 SASI_Mm02_00317051 predicted 837
11 SASI_Mm01_00099333 predicted 526
12 SASI_Mm01_00099336 predicted 503
13 SASI_Mm01_00099337 predicted 537
14 SASI_Mm01_00099338 predicted 500
15 SASI_Mm01_00099340 predicted 426
16 SASI_Mm01_00099341 predicted 334
17 SASI_Mm01_00099342 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177407 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347598 predicted 1969
2 SASI_Mm02_00347599 predicted 1415
3 SASI_Mm02_00347600 predicted 1433
4 SASI_Mm02_00347601 predicted 1643
5 SASI_Mm02_00347602 predicted 1706
6 SASI_Mm02_00347603 predicted 1529
7 SASI_Mm02_00347604 predicted 1396
8 SASI_Mm02_00347605 predicted 2064
9 SASI_Mm02_00347606 predicted 1959
10 SASI_Mm02_00347607 predicted 1521
11 SASI_Mm01_00174759 predicted 1114
12 SASI_Mm01_00174760 predicted 1631
13 SASI_Mm01_00174761 predicted 410
14 SASI_Mm01_00174762 predicted 1175
15 SASI_Mm01_00174763 predicted 1189
16 SASI_Mm01_00174764 predicted 1226
17 SASI_Mm01_00174765 predicted 1188
18 SASI_Mm01_00174766 predicted 448
19 SASI_Mm01_00174767 predicted 408
20 SASI_Mm01_00174768 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009792
CAMK2A MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-430s1c1
Sequence:CCGGGCGTTCAGTTAATGGAATCTTCTCGAGAAGATTCCATTAACTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-632s1c1
Sequence:CCGGCCTGGACTTTCATCGATTCTACTCGAGTAGAATCGATGAAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-527s1c1
Sequence:CCGGGCTGATCGAAGCCATAAGCAACTCGAGTTGCTTATGGCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-336s1c1
Sequence:CCGGGTGTTGCTAACCCTCTACTTTCTCGAGAAAGTAGAGGGTTAGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-495s1c1
Sequence:CCGGCGCAAACAGGAAATTATCAAACTCGAGTTTGATAATTTCCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-927s21c1
Sequence:CCGGTTCGCAGAGATCCGCTCTTTGCTCGAGCAAAGAGCGGATCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-634s21c1
Sequence:CCGGTGGACTTTCATCGATTCTATTCTCGAGAATAGAATCGATGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-1197s21c1
Sequence:CCGGTGTTGGCCTAGCCTAGCTTTACTCGAGTAAAGCTAGGCTAGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-733s21c1
Sequence:CCGGAGTCAGCCTGCATCGCCTATACTCGAGTATAGGCGATGCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009792
CAMK2A MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-430s1c1
Sequence:CCGGGCGTTCAGTTAATGGAATCTTCTCGAGAAGATTCCATTAACTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-632s1c1
Sequence:CCGGCCTGGACTTTCATCGATTCTACTCGAGTAGAATCGATGAAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-527s1c1
Sequence:CCGGGCTGATCGAAGCCATAAGCAACTCGAGTTGCTTATGGCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-336s1c1
Sequence:CCGGGTGTTGCTAACCCTCTACTTTCTCGAGAAAGTAGAGGGTTAGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-495s1c1
Sequence:CCGGCGCAAACAGGAAATTATCAAACTCGAGTTTGATAATTTCCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-927s21c1
Sequence:CCGGTTCGCAGAGATCCGCTCTTTGCTCGAGCAAAGAGCGGATCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-634s21c1
Sequence:CCGGTGGACTTTCATCGATTCTATTCTCGAGAATAGAATCGATGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-1197s21c1
Sequence:CCGGTGTTGGCCTAGCCTAGCTTTACTCGAGTAAAGCTAGGCTAGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-733s21c1
Sequence:CCGGAGTCAGCCTGCATCGCCTATACTCGAGTATAGGCGATGCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009792
CAMK2A MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-430s1c1
Sequence:CCGGGCGTTCAGTTAATGGAATCTTCTCGAGAAGATTCCATTAACTGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-632s1c1
Sequence:CCGGCCTGGACTTTCATCGATTCTACTCGAGTAGAATCGATGAAAGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-527s1c1
Sequence:CCGGGCTGATCGAAGCCATAAGCAACTCGAGTTGCTTATGGCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-336s1c1
Sequence:CCGGGTGTTGCTAACCCTCTACTTTCTCGAGAAAGTAGAGGGTTAGCAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009792.1-495s1c1
Sequence:CCGGCGCAAACAGGAAATTATCAAACTCGAGTTTGATAATTTCCTGTTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-927s21c1
Sequence:CCGGTTCGCAGAGATCCGCTCTTTGCTCGAGCAAAGAGCGGATCTCTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-634s21c1
Sequence:CCGGTGGACTTTCATCGATTCTATTCTCGAGAATAGAATCGATGAAAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009792.3-1197s21c1
Sequence:CCGGTGTTGGCCTAGCCTAGCTTTACTCGAGTAAAGCTAGGCTAGGCCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009792.3-733s21c1
Sequence:CCGGAGTCAGCCTGCATCGCCTATACTCGAGTATAGGCGATGCAGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_171825
CAMK2A MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1116s1c1
Sequence:CCGGAGAGCGATGGTGTGAAGGAATCTCGAGATTCCTTCACACCATCGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1181s1c1
Sequence:CCGGGTGCGGAAACAGGAAATTATACTCGAGTATAATTTCCTGTTTCCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-904s1c1
Sequence:CCGGGACCATTAACCCATCCAAACGCTCGAGCGTTTGGATGGGTTAATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-394s1c1
Sequence:CCGGGGGACACCACTACCTGATCTTCTCGAGAAGATCAGGTAGTGGTGTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-356s1c1
Sequence:CCGGCCCAACATCGTCCGACTACATCTCGAGATGTAGTCGGACGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2808s1c1
Sequence:CCGGCAGGATTTCATCTCACCATATCTCGAGATATGGTGAGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-3080s1c1
Sequence:CCGGCATGACTTTATACGCAGTAAGCTCGAGCTTACTGCGTATAAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2406s1c1
Sequence:CCGGCGTAAATGGATTTCGCGTTAACTCGAGTTAACGCGAAATCCATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-878s1c1
Sequence:CCGGGCCAAGGATCTGATCAATAAGCTCGAGCTTATTGATCAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_171825
CAMK2A MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1116s1c1
Sequence:CCGGAGAGCGATGGTGTGAAGGAATCTCGAGATTCCTTCACACCATCGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1181s1c1
Sequence:CCGGGTGCGGAAACAGGAAATTATACTCGAGTATAATTTCCTGTTTCCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-904s1c1
Sequence:CCGGGACCATTAACCCATCCAAACGCTCGAGCGTTTGGATGGGTTAATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-394s1c1
Sequence:CCGGGGGACACCACTACCTGATCTTCTCGAGAAGATCAGGTAGTGGTGTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-356s1c1
Sequence:CCGGCCCAACATCGTCCGACTACATCTCGAGATGTAGTCGGACGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2808s1c1
Sequence:CCGGCAGGATTTCATCTCACCATATCTCGAGATATGGTGAGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-3080s1c1
Sequence:CCGGCATGACTTTATACGCAGTAAGCTCGAGCTTACTGCGTATAAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2406s1c1
Sequence:CCGGCGTAAATGGATTTCGCGTTAACTCGAGTTAACGCGAAATCCATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-878s1c1
Sequence:CCGGGCCAAGGATCTGATCAATAAGCTCGAGCTTATTGATCAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_171825
CAMK2A MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1116s1c1
Sequence:CCGGAGAGCGATGGTGTGAAGGAATCTCGAGATTCCTTCACACCATCGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-1181s1c1
Sequence:CCGGGTGCGGAAACAGGAAATTATACTCGAGTATAATTTCCTGTTTCCGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-904s1c1
Sequence:CCGGGACCATTAACCCATCCAAACGCTCGAGCGTTTGGATGGGTTAATGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.x-394s1c1
Sequence:CCGGGGGACACCACTACCTGATCTTCTCGAGAAGATCAGGTAGTGGTGTCCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-356s1c1
Sequence:CCGGCCCAACATCGTCCGACTACATCTCGAGATGTAGTCGGACGATGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194685    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2808s1c1
Sequence:CCGGCAGGATTTCATCTCACCATATCTCGAGATATGGTGAGATGAAATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194797    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-3080s1c1
Sequence:CCGGCATGACTTTATACGCAGTAAGCTCGAGCTTACTGCGTATAAAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_171825.1-2406s1c1
Sequence:CCGGCGTAAATGGATTTCGCGTTAACTCGAGTTAACGCGAAATCCATTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_171825.1-878s1c1
Sequence:CCGGGCCAAGGATCTGATCAATAAGCTCGAGCTTATTGATCAGATCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks