EMAIL THIS PAGE TO A FRIEND

CAMK2B

calcium/calmodulin-dependent protein kinase II beta

179 Gene Product Result for
Synonyms: CAM2 CAMK2 CAMKB
Gene ID:
Human(816) Summary: The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Eight transcript variants encoding eight distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(12323) calcium/calmodulin-dependent protein kinase II, beta
Rat(24245) calcium/calmodulin-dependent protein kinase II beta
chicken(374174) calcium/calmodulin-dependent protein kinase II beta
dog(608846) calcium/calmodulin-dependent protein kinase II beta
domestic cat(101098615) calcium/calmodulin-dependent protein kinase II beta
cow(525416) calcium/calmodulin-dependent protein kinase II beta
Horse(100146368) calcium/calmodulin-dependent protein kinase II beta
domestic guinea pig(100717077) calcium/calmodulin-dependent protein kinase II beta
naked mole-rat(101718749) calcium/calmodulin-dependent protein kinase II beta
sheep(101118870) calcium/calmodulin-dependent protein kinase II beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503244 Anti-CAMK2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
C5244 Anti-CAMK2B (30-44) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C5369 Anti-CAMK2B (641-655) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA026307 Anti-CAMK2B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human
immunohistochemistry, western blot pricing
SAB1302611 ANTI-MOUSE CAMK2B (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4503756 Anti-phospho-CaMK2 α/β/δ (pThr305) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504607 Anti-phospho-CaMK2-β/γ/δ (pThr287) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301561 Anti-phospho-CaMK2-β/γ/δ (pThr287) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB1403630 Monoclonal Anti-CAMK2B antibody produced in mouse clone S11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1409845 Monoclonal Anti-CAMK2B antibody produced in mouse clone 6D6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409846 Monoclonal Anti-CAMK2B antibody produced in mouse clone S12, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
A3281 N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride human pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A4308 Autocamtide 2-related inhibitory peptide ≥97% (HPLC), lyophilized powder human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0087 AQUA Peptide DLKPENLLLAS[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007595 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007595 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007595 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001220 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059191 MISSION® esiRNA esiRNA human CAMK2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001220 Rosetta Predictions human pricing
NM_172078 Rosetta Predictions human pricing
NM_172079 Rosetta Predictions human pricing
NM_172080 Rosetta Predictions human pricing
NM_172081 Rosetta Predictions human pricing
NM_172082 Rosetta Predictions human pricing
NM_172083 Rosetta Predictions human pricing
NM_172084 Rosetta Predictions human pricing
NM_001042354 Rosetta Predictions rat pricing
NM_001042356 Rosetta Predictions rat pricing
NM_021739 Rosetta Predictions rat pricing
NM_007595 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230999 predicted 388
2 SASI_Hs01_00231000 predicted 663
3 SASI_Hs01_00231001 predicted 568
4 SASI_Hs01_00231002 predicted 918
5 SASI_Hs01_00231003 predicted 294
6 SASI_Hs01_00231004 predicted 618
7 SASI_Hs01_00231005 predicted 312
8 SASI_Hs02_00331375 predicted 1901
9 SASI_Hs02_00331376 predicted 1941
10 SASI_Hs01_00231006 predicted 1838
11 SASI_Hs01_00231007 predicted 1947
12 SASI_Hs01_00231008 predicted 1841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033652 predicted 391
2 SASI_Hs01_00033653 predicted 665
3 SASI_Hs01_00033654 predicted 571
4 SASI_Hs01_00033655 predicted 922
5 SASI_Hs01_00033656 predicted 302
6 SASI_Hs01_00033657 predicted 620
7 SASI_Hs01_00033658 predicted 309
8 SASI_Hs02_00367800 predicted 1522
9 SASI_Hs02_00367801 predicted 1567
10 SASI_Hs01_00033659 predicted 1471
11 SASI_Hs01_00033660 predicted 1575
12 SASI_Hs01_00033661 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213748 predicted 391
2 SASI_Hs01_00213749 predicted 666
3 SASI_Hs01_00213750 predicted 569
4 SASI_Hs01_00213751 predicted 917
5 SASI_Hs01_00213752 predicted 298
6 SASI_Hs01_00213753 predicted 625
7 SASI_Hs01_00213754 predicted 313
8 SASI_Hs01_00213755 predicted 1145
9 SASI_Hs02_00367802 predicted 1453
10 SASI_Hs01_00213756 predicted 1492
11 SASI_Hs01_00213757 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051488 predicted 386
2 SASI_Hs01_00051489 predicted 665
3 SASI_Hs01_00051490 predicted 564
4 SASI_Hs01_00051491 predicted 914
5 SASI_Hs01_00051492 predicted 302
6 SASI_Hs01_00051493 predicted 623
7 SASI_Hs01_00051494 predicted 313
8 SASI_Hs02_00367803 predicted 1450
9 SASI_Hs01_00051495 predicted 1147
10 SASI_Hs01_00051496 predicted 1490
11 SASI_Hs01_00051497 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228945 predicted 390
2 SASI_Hs01_00228946 predicted 667
3 SASI_Hs01_00228947 predicted 571
4 SASI_Hs01_00228948 predicted 919
5 SASI_Hs01_00228949 predicted 297
6 SASI_Hs01_00228950 predicted 619
7 SASI_Hs01_00228951 predicted 308
8 SASI_Hs01_00228952 predicted 1143
9 SASI_Hs01_00228953 predicted 1404
10 SASI_Hs01_00228954 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245222 predicted 389
2 SASI_Hs01_00245223 predicted 662
3 SASI_Hs01_00245224 predicted 568
4 SASI_Hs01_00245225 predicted 920
5 SASI_Hs01_00245226 predicted 296
6 SASI_Hs01_00245227 predicted 627
7 SASI_Hs01_00245228 predicted 312
8 SASI_Hs01_00245229 predicted 1416
9 SASI_Hs02_00367804 predicted 1691
10 SASI_Hs01_00245230 predicted 1400
11 SASI_Hs01_00245231 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228612 predicted 391
2 SASI_Hs01_00228613 predicted 669
3 SASI_Hs01_00228614 predicted 570
4 SASI_Hs01_00228615 predicted 919
5 SASI_Hs01_00228616 predicted 299
6 SASI_Hs01_00228617 predicted 624
7 SASI_Hs01_00228618 predicted 308
8 SASI_Hs01_00228619 predicted 1145
9 SASI_Hs01_00228620 predicted 1332
10 SASI_Hs01_00228621 predicted 1381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172084 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245712 predicted 384
2 SASI_Hs01_00245713 predicted 669
3 SASI_Hs01_00245714 predicted 571
4 SASI_Hs01_00245715 predicted 917
5 SASI_Hs01_00245716 predicted 296
6 SASI_Hs01_00245717 predicted 623
7 SASI_Hs01_00245718 predicted 307
8 SASI_Hs01_00245719 predicted 1244
9 SASI_Hs02_00367805 predicted 1561
10 SASI_Hs01_00245720 predicted 1289
11 SASI_Hs01_00245721 predicted 1201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042354 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054054 predicted 603
2 SASI_Rn01_00054055 predicted 606
3 SASI_Rn01_00054056 predicted 272
4 SASI_Rn01_00054057 predicted 634
5 SASI_Rn01_00054058 predicted 1698
6 SASI_Rn02_00204916 predicted 268
7 SASI_Rn01_00054059 predicted 1693
8 SASI_Rn01_00054061 predicted 1713
9 SASI_Rn01_00054063 predicted 711
10 SASI_Rn02_00204917 predicted 594
11 SASI_Rn01_00054060 predicted 743
12 SASI_Rn01_00054062 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065092 predicted 598
2 SASI_Rn01_00065093 predicted 607
3 SASI_Rn01_00065094 predicted 271
4 SASI_Rn01_00065095 predicted 638
5 SASI_Rn01_00065096 predicted 1437
6 SASI_Rn02_00204918 predicted 260
7 SASI_Rn01_00065097 predicted 1436
8 SASI_Rn01_00065099 predicted 1452
9 SASI_Rn01_00065101 predicted 709
10 SASI_Rn02_00204919 predicted 593
11 SASI_Rn01_00065098 predicted 739
12 SASI_Rn01_00065100 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059715 predicted 607
2 SASI_Rn01_00059716 predicted 605
3 SASI_Rn01_00059717 predicted 272
4 SASI_Rn01_00059718 predicted 637
5 SASI_Rn01_00059719 predicted 1559
6 SASI_Rn02_00262755 predicted 263
7 SASI_Rn01_00059720 predicted 1553
8 SASI_Rn01_00059722 predicted 1571
9 SASI_Rn01_00059724 predicted 708
10 SASI_Rn02_00262756 predicted 591
11 SASI_Rn01_00059721 predicted 741
12 SASI_Rn01_00059723 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007595 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141324 predicted 358
2 SASI_Mm01_00141325 predicted 1532
3 SASI_Mm01_00141326 predicted 1339
4 SASI_Mm01_00141327 predicted 333
5 SASI_Mm01_00141328 predicted 1136
6 SASI_Mm01_00141329 predicted 321
7 SASI_Mm01_00141330 predicted 1069
8 SASI_Mm01_00141331 predicted 1230
9 SASI_Mm01_00141332 predicted 1120
10 SASI_Mm01_00141333 predicted 1135
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007595
CAMK2B MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-1441s21c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-318s21c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-978s21c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007595.4-3615s21c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007595.2-3706s1c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1069s1c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-409s1c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-250s1c1
Sequence:CCGGGTACCATCTATACGAGGATATCTCGAGATATCCTCGTATAGATGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1532s1c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007595
CAMK2B MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-1441s21c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-318s21c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-978s21c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007595.4-3615s21c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007595.2-3706s1c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1069s1c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-409s1c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-250s1c1
Sequence:CCGGGTACCATCTATACGAGGATATCTCGAGATATCCTCGTATAGATGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1532s1c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007595
CAMK2B MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-1441s21c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-318s21c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007595.4-978s21c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319741    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007595.4-3615s21c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007595.2-3706s1c1
Sequence:CCGGCCACCTTGTTATCTCCACAAACTCGAGTTTGTGGAGATAACAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1069s1c1
Sequence:CCGGGACTGTGGAATGTCTGAAGAACTCGAGTTCTTCAGACATTCCACAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-409s1c1
Sequence:CCGGCCTGCTGAAGCATTCCAACATCTCGAGATGTTGGAATGCTTCAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-250s1c1
Sequence:CCGGGTACCATCTATACGAGGATATCTCGAGATATCCTCGTATAGATGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007595.2-1532s1c1
Sequence:CCGGCTGACCTCATTTGAGCCTGAACTCGAGTTCAGGCTCAAATGAGGTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001220
VALIDATED
CAMK2B MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-244s1c1
Sequence:CCGGTACCAGCTCTACGAGGATATTCTCGAGAATATCCTCGTAGAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1408s1c1
Sequence:CCGGATAGAGGATGAAGACGCTAAACTCGAGTTTAGCGTCTTCATCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001220.3-2281s1c1
Sequence:CCGGCGCATGTTTGTGTCTGCCTCGCTCGAGCGAGGCAGACACAAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1803s1c1
Sequence:CCGGCCGGAAGCAGGAGATCATTAACTCGAGTTAATGATCTCCTGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-751s1c1
Sequence:CCGGCCTGAGGTCCTTCGCAAAGAGCTCGAGCTCTTTGCGAAGGACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-2338s1c1
Sequence:CCGGGACCAGATGTGATTTGTTAAACTCGAGTTTAACAAATCACATCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1815s1c1
Sequence:CCGGGATCATTAAGACCACGGAGCACTCGAGTGCTCCGTGGTCTTAATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1340s1c1
Sequence:CCGGCTCAAACCACCGTCATCCATACTCGAGTATGGATGACGGTGGTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1681s1c1
Sequence:CCGGATCTCTGACATCCTGAACTCTCTCGAGAGAGTTCAGGATGTCAGAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1241s1c1
Sequence:CCGGACAAGAAAGCAGATGGAGTCACTCGAGTGACTCCATCTGCTTTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001220
VALIDATED
CAMK2B MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-244s1c1
Sequence:CCGGTACCAGCTCTACGAGGATATTCTCGAGAATATCCTCGTAGAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1408s1c1
Sequence:CCGGATAGAGGATGAAGACGCTAAACTCGAGTTTAGCGTCTTCATCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001220.3-2281s1c1
Sequence:CCGGCGCATGTTTGTGTCTGCCTCGCTCGAGCGAGGCAGACACAAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1803s1c1
Sequence:CCGGCCGGAAGCAGGAGATCATTAACTCGAGTTAATGATCTCCTGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-751s1c1
Sequence:CCGGCCTGAGGTCCTTCGCAAAGAGCTCGAGCTCTTTGCGAAGGACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-2338s1c1
Sequence:CCGGGACCAGATGTGATTTGTTAAACTCGAGTTTAACAAATCACATCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1815s1c1
Sequence:CCGGGATCATTAAGACCACGGAGCACTCGAGTGCTCCGTGGTCTTAATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1340s1c1
Sequence:CCGGCTCAAACCACCGTCATCCATACTCGAGTATGGATGACGGTGGTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1681s1c1
Sequence:CCGGATCTCTGACATCCTGAACTCTCTCGAGAGAGTTCAGGATGTCAGAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1241s1c1
Sequence:CCGGACAAGAAAGCAGATGGAGTCACTCGAGTGACTCCATCTGCTTTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001220
VALIDATED
CAMK2B MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-244s1c1
Sequence:CCGGTACCAGCTCTACGAGGATATTCTCGAGAATATCCTCGTAGAGCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219643    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1408s1c1
Sequence:CCGGATAGAGGATGAAGACGCTAAACTCGAGTTTAGCGTCTTCATCCTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199539    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001220.3-2281s1c1
Sequence:CCGGCGCATGTTTGTGTCTGCCTCGCTCGAGCGAGGCAGACACAAACATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-1803s1c1
Sequence:CCGGCCGGAAGCAGGAGATCATTAACTCGAGTTAATGATCTCCTGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199243    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001220.3-751s1c1
Sequence:CCGGCCTGAGGTCCTTCGCAAAGAGCTCGAGCTCTTTGCGAAGGACCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000466    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-2338s1c1
Sequence:CCGGGACCAGATGTGATTTGTTAAACTCGAGTTTAACAAATCACATCTGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1815s1c1
Sequence:CCGGGATCATTAAGACCACGGAGCACTCGAGTGCTCCGTGGTCTTAATGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1340s1c1
Sequence:CCGGCTCAAACCACCGTCATCCATACTCGAGTATGGATGACGGTGGTTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001220.x-1681s1c1
Sequence:CCGGATCTCTGACATCCTGAACTCTCTCGAGAGAGTTCAGGATGTCAGAGATTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001220.x-1241s1c1
Sequence:CCGGACAAGAAAGCAGATGGAGTCACTCGAGTGACTCCATCTGCTTTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks