EMAIL THIS PAGE TO A FRIEND

CAMK2D

calcium/calmodulin-dependent protein kinase II delta

268 Gene Product Result for
Synonyms: CAMKD
Gene ID:
Human(817) Summary: The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
Mouse(108058) calcium/calmodulin-dependent protein kinase II, delta
Rat(24246) calcium/calmodulin-dependent protein kinase II delta
chicken(422688) calcium/calmodulin-dependent protein kinase II delta
cow(532713) calcium/calmodulin-dependent protein kinase II delta
Horse(100072618) calcium/calmodulin-dependent protein kinase II delta
domestic cat(101098221) calcium/calmodulin-dependent protein kinase II delta
dog(610764) calcium/calmodulin-dependent protein kinase II delta
sheep(101113850) calcium/calmodulin-dependent protein kinase II delta
domestic guinea pig(100719406) calcium/calmodulin-dependent protein kinase II delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051783 Anti-CAMK2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA051785 Anti-CAMK2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA053973 Anti-CAMK2A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
C5494 Anti-CAMK2D (33-47) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
HPA026281 Anti-CAMK2D antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1411473 Anti-CAMK2D antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1302231 ANTI-MOUSE CAMK2D (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4504356 Anti-phospho-CaMK2 (pThr286) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503756 Anti-phospho-CaMK2 α/β/δ (pThr305) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504607 Anti-phospho-CaMK2-β/γ/δ (pThr287) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
WH0000817M2 Monoclonal Anti-CAMK2D antibody produced in mouse clone 1A8, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1403631 Monoclonal Anti-CAMK2D antibody produced in mouse clone 2E1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1409854 Monoclonal Anti-CAMK2D antibody produced in mouse clone 1B11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Substrate

Product # Description Species Add to Cart
 
A4308 Autocamtide 2-related inhibitory peptide ≥97% (HPLC), lyophilized powder human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0087 AQUA Peptide DLKPENLLLAS[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023813 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023813 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023813 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001221 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001221 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001221 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001221 Rosetta Predictions human pricing
NM_172115 Rosetta Predictions human pricing
NM_172127 Rosetta Predictions human pricing
NM_172128 Rosetta Predictions human pricing
NM_012519 Rosetta Predictions rat pricing
NM_001025438 Rosetta Predictions mouse pricing
NM_001025439 Rosetta Predictions mouse pricing
NM_023813 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001221 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202407 predicted 825
2 SASI_Hs02_00331377 predicted 1492
3 SASI_Hs01_00202409 predicted 1314
4 SASI_Hs01_00202410 predicted 855
5 SASI_Hs01_00202411 predicted 753
6 SASI_Hs01_00202412 predicted 1547
7 SASI_Hs01_00202413 predicted 1482
8 SASI_Hs02_00331378 predicted 1056
9 SASI_Hs01_00202414 predicted 1238
10 SASI_Hs01_00202415 predicted 1553
11 SASI_Hs01_00202406 predicted 760
12 SASI_Hs01_00202408 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172115 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182433 predicted 824
2 SASI_Hs02_00367842 predicted 1495
3 SASI_Hs01_00182435 predicted 1310
4 SASI_Hs01_00182436 predicted 859
5 SASI_Hs01_00182437 predicted 751
6 SASI_Hs01_00182438 predicted 1544
7 SASI_Hs01_00182439 predicted 1479
8 SASI_Hs02_00367843 predicted 1060
9 SASI_Hs01_00182440 predicted 1231
10 SASI_Hs01_00182441 predicted 1556
11 SASI_Hs01_00182432 predicted 758
12 SASI_Hs01_00182434 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035667 predicted 819
2 SASI_Hs02_00367844 predicted 1492
3 SASI_Hs01_00035669 predicted 1316
4 SASI_Hs01_00035670 predicted 860
5 SASI_Hs01_00035671 predicted 759
6 SASI_Hs01_00035672 predicted 1541
7 SASI_Hs01_00035673 predicted 1477
8 SASI_Hs02_00367845 predicted 1057
9 SASI_Hs01_00035674 predicted 1234
10 SASI_Hs01_00035675 predicted 1560
11 SASI_Hs01_00035666 predicted 766
12 SASI_Hs01_00035668 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192906 predicted 824
2 SASI_Hs02_00367846 predicted 1495
3 SASI_Hs01_00192908 predicted 1318
4 SASI_Hs01_00192909 predicted 851
5 SASI_Hs01_00192910 predicted 750
6 SASI_Hs01_00192911 predicted 1547
7 SASI_Hs01_00192912 predicted 1474
8 SASI_Hs02_00367847 predicted 1063
9 SASI_Hs01_00192913 predicted 1232
10 SASI_Hs01_00192914 predicted 1553
11 SASI_Hs01_00192905 predicted 766
12 SASI_Hs01_00192907 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012519 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079851 predicted 577
2 SASI_Rn01_00079852 predicted 1352
3 SASI_Rn01_00079853 predicted 778
4 SASI_Rn02_00259591 predicted 879
5 SASI_Rn01_00079855 predicted 1041
6 SASI_Rn01_00079856 predicted 1637
7 SASI_Rn01_00079857 predicted 1315
8 SASI_Rn01_00079858 predicted 683
9 SASI_Rn02_00259592 predicted 881
10 SASI_Rn02_00259593 predicted 1622
11 SASI_Rn01_00079854 predicted 1629
12 SASI_Rn01_00079859 predicted 1033
13 SASI_Rn01_00079860 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025438 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069306 predicted 1223
2 SASI_Mm01_00069307 predicted 536
3 SASI_Mm01_00069308 predicted 507
4 SASI_Mm02_00287879 predicted 1194
5 SASI_Mm01_00069310 predicted 534
6 SASI_Mm01_00069311 predicted 814
7 SASI_Mm01_00069312 predicted 1022
8 SASI_Mm02_00287880 predicted 798
9 SASI_Mm01_00069313 predicted 1751
10 SASI_Mm02_00287881 predicted 1481
11 SASI_Mm01_00069309 predicted 543
12 SASI_Mm01_00069314 predicted 1031
13 SASI_Mm01_00069315 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00072274 predicted 1219
2 SASI_Mm01_00072275 predicted 538
3 SASI_Mm01_00072276 predicted 511
4 SASI_Mm02_00287882 predicted 1201
5 SASI_Mm01_00072278 predicted 532
6 SASI_Mm01_00072279 predicted 1022
7 SASI_Mm01_00072280 predicted 1856
8 SASI_Mm02_00287883 predicted 1577
9 SASI_Mm01_00072282 predicted 1543
10 SASI_Mm01_00072283 predicted 1516
11 SASI_Mm01_00072277 predicted 551
12 SASI_Mm01_00072281 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023813 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142029 predicted 1220
2 SASI_Mm01_00142030 predicted 539
3 SASI_Mm01_00142031 predicted 510
4 SASI_Mm02_00327368 predicted 1194
5 SASI_Mm01_00142033 predicted 536
6 SASI_Mm01_00142034 predicted 819
7 SASI_Mm01_00142035 predicted 1021
8 SASI_Mm02_00327369 predicted 800
9 SASI_Mm01_00142036 predicted 1747
10 SASI_Mm01_00142038 predicted 814
11 SASI_Mm01_00142032 predicted 546
12 SASI_Mm01_00142037 predicted 1024
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023813
VALIDATED
CAMK2D MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II delta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1175s1c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-767s1c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1254s1c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1698s1c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023813.2-668s1c1
Sequence:CCGGGCGTAAAGATCCTTATGGAAACTCGAGTTTCCATAAGGATCTTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023813.3-2055s21c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1532s21c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1124s21c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1611s21c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023813
VALIDATED
CAMK2D MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II delta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1175s1c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-767s1c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1254s1c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1698s1c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023813.2-668s1c1
Sequence:CCGGGCGTAAAGATCCTTATGGAAACTCGAGTTTCCATAAGGATCTTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023813.3-2055s21c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1532s21c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1124s21c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1611s21c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023813
VALIDATED
CAMK2D MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II delta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1175s1c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-767s1c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1254s1c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023813.2-1698s1c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023813.2-668s1c1
Sequence:CCGGGCGTAAAGATCCTTATGGAAACTCGAGTTTCCATAAGGATCTTTACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023813.3-2055s21c1
Sequence:CCGGCACGTCATCTTATCATGTATTCTCGAGAATACATGATAAGATGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1532s21c1
Sequence:CCGGGCAACTGATTGAAGCTATCAACTCGAGTTGATAGCTTCAATCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1124s21c1
Sequence:CCGGGCATAGACTGTATCAGCAGATCTCGAGATCTGCTGATACAGTCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023813.3-1611s21c1
Sequence:CCGGCCTGAAGCATTGGGCAACTTACTCGAGTAAGTTGCCCAATGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001221
VALIDATED
CAMK2D MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II delta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-2053s1c1
Sequence:CCGGCTTCTGCATTCTCTGTTCTCACTCGAGTGAGAACAGAGAATGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1261s1c1
Sequence:CCGGCTTACTATCAACCCTGCCAAACTCGAGTTTGGCAGGGTTGATAGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-1475s1c1
Sequence:CCGGCAGATGGAGTAAAGGAGTCAACTCGAGTTGACTCCTTTACTCCATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1721s1c1
Sequence:CCGGGCAATAAACCAATCCACACTACTCGAGTAGTGTGGATTGGTTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1917s1c1
Sequence:CCGGGTCACCAACAGTACCCATCAACTCGAGTTGATGGGTACTGTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1312s1c1
Sequence:CCGGCCATGGATCTGTCAACGTTCTCTCGAGAGAACGTTGACAGATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1648s1c1
Sequence:CCGGCCTGAAGCTTTGGGTAATTTACTCGAGTAAATTACCCAAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-714s1c1
Sequence:CCGGCCCTAATATTGTGCGACTTCACTCGAGTGAAGTCGCACAATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1834s1c1
Sequence:CCGGCCAAAGACAATGCAGTCAGAACTCGAGTTCTGACTGCATTGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1229s21c1
Sequence:CCGGGTTAATCATTGTCACCTAAATCTCGAGATTTAGGTGACAATGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1929s21c1
Sequence:CCGGTGATCGAAGCTATCAACAATGCTCGAGCATTGTTGATAGCTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001221
VALIDATED
CAMK2D MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II delta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-2053s1c1
Sequence:CCGGCTTCTGCATTCTCTGTTCTCACTCGAGTGAGAACAGAGAATGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1261s1c1
Sequence:CCGGCTTACTATCAACCCTGCCAAACTCGAGTTTGGCAGGGTTGATAGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-1475s1c1
Sequence:CCGGCAGATGGAGTAAAGGAGTCAACTCGAGTTGACTCCTTTACTCCATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1721s1c1
Sequence:CCGGGCAATAAACCAATCCACACTACTCGAGTAGTGTGGATTGGTTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1917s1c1
Sequence:CCGGGTCACCAACAGTACCCATCAACTCGAGTTGATGGGTACTGTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1312s1c1
Sequence:CCGGCCATGGATCTGTCAACGTTCTCTCGAGAGAACGTTGACAGATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1648s1c1
Sequence:CCGGCCTGAAGCTTTGGGTAATTTACTCGAGTAAATTACCCAAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-714s1c1
Sequence:CCGGCCCTAATATTGTGCGACTTCACTCGAGTGAAGTCGCACAATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1834s1c1
Sequence:CCGGCCAAAGACAATGCAGTCAGAACTCGAGTTCTGACTGCATTGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1229s21c1
Sequence:CCGGGTTAATCATTGTCACCTAAATCTCGAGATTTAGGTGACAATGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1929s21c1
Sequence:CCGGTGATCGAAGCTATCAACAATGCTCGAGCATTGTTGATAGCTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001221
VALIDATED
CAMK2D MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II delta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-2053s1c1
Sequence:CCGGCTTCTGCATTCTCTGTTCTCACTCGAGTGAGAACAGAGAATGCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1261s1c1
Sequence:CCGGCTTACTATCAACCCTGCCAAACTCGAGTTTGGCAGGGTTGATAGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.x-1475s1c1
Sequence:CCGGCAGATGGAGTAAAGGAGTCAACTCGAGTTGACTCCTTTACTCCATCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.x-1721s1c1
Sequence:CCGGGCAATAAACCAATCCACACTACTCGAGTAGTGTGGATTGGTTTATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1917s1c1
Sequence:CCGGGTCACCAACAGTACCCATCAACTCGAGTTGATGGGTACTGTTGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1312s1c1
Sequence:CCGGCCATGGATCTGTCAACGTTCTCTCGAGAGAACGTTGACAGATCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001221.2-1648s1c1
Sequence:CCGGCCTGAAGCTTTGGGTAATTTACTCGAGTAAATTACCCAAAGCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-714s1c1
Sequence:CCGGCCCTAATATTGTGCGACTTCACTCGAGTGAAGTCGCACAATATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001221.2-1834s1c1
Sequence:CCGGCCAAAGACAATGCAGTCAGAACTCGAGTTCTGACTGCATTGTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1229s21c1
Sequence:CCGGGTTAATCATTGTCACCTAAATCTCGAGATTTAGGTGACAATGATTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001221.3-1929s21c1
Sequence:CCGGTGATCGAAGCTATCAACAATGCTCGAGCATTGTTGATAGCTTCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks