EMAIL THIS PAGE TO A FRIEND

CAMK2G

calcium/calmodulin-dependent protein kinase II gamma

299 Gene Product Result for
Synonyms: CAMK CAMK-II CAMKG
Gene ID:
Human(818) Summary: The product of this gene is one of the four subunits of an enzyme which belongs to the serine/threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a gamma chain. Many alternatively spliced transcripts encoding different isoforms have been described but the full-length nature of all the variants has not been determined.[provided by RefSeq, Mar 2011]
Mouse(12325) calcium/calmodulin-dependent protein kinase II gamma
Rat(171140) calcium/calmodulin-dependent protein kinase II gamma
chicken(423737) calcium/calmodulin-dependent protein kinase II gamma
dog(489050) calcium/calmodulin-dependent protein kinase II gamma
domestic cat(101098090) calcium/calmodulin-dependent protein kinase II gamma
Horse(100064138) calcium/calmodulin-dependent protein kinase II gamma
cow(282162) calcium/calmodulin-dependent protein kinase II gamma
domestic guinea pig(100725858) calcium/calmodulin-dependent protein kinase II gamma
naked mole-rat(101713923) calcium/calmodulin-dependent protein kinase II gamma
sheep(101108884) calcium/calmodulin-dependent protein kinase II gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503245 Anti-CAMK2, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB1300104 Anti-CAMK2δ-like (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1300105 Anti-CAMK2γ (C-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1400037 Anti-CAMK2G antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1400038 Anti-CAMK2G antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1400039 Anti-CAMK2G antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
HPA040656 Anti-CAMK2G antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB1302610 ANTI-MOUSE CAMK2G (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504607 Anti-phospho-CaMK2-β/γ/δ (pThr287) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0087 AQUA Peptide DLKPENLLLAS[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, pig, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001222 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001222 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001222 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001222 Rosetta Predictions human pricing
NM_172169 Rosetta Predictions human pricing
NM_172170 Rosetta Predictions human pricing
NM_172171 Rosetta Predictions human pricing
NM_172172 Rosetta Predictions human pricing
NM_172173 Rosetta Predictions human pricing
NM_133605 Rosetta Predictions rat pricing
NM_001039138 Rosetta Predictions mouse pricing
NM_001039139 Rosetta Predictions mouse pricing
NM_178597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001222 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118118 predicted 440
2 SASI_Hs02_00331379 predicted 836
3 SASI_Hs01_00118121 predicted 454
4 SASI_Hs02_00331380 predicted 368
5 SASI_Hs01_00118122 predicted 530
6 SASI_Hs01_00118123 predicted 365
7 SASI_Hs01_00118124 predicted 1464
8 SASI_Hs01_00118125 predicted 743
9 SASI_Hs01_00118126 predicted 669
10 SASI_Hs01_00118127 predicted 2065
11 SASI_Hs01_00118119 predicted 1546
12 SASI_Hs01_00118120 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172169 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033802 predicted 448
2 SASI_Hs02_00367870 predicted 839
3 SASI_Hs01_00033805 predicted 455
4 SASI_Hs02_00367871 predicted 368
5 SASI_Hs01_00033806 predicted 535
6 SASI_Hs01_00033807 predicted 361
7 SASI_Hs01_00033808 predicted 1564
8 SASI_Hs01_00033809 predicted 739
9 SASI_Hs01_00033810 predicted 664
10 SASI_Hs01_00033811 predicted 2163
11 SASI_Hs01_00033803 predicted 1648
12 SASI_Hs01_00033804 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081144 predicted 449
2 SASI_Hs02_00367872 predicted 839
3 SASI_Hs01_00081147 predicted 465
4 SASI_Hs02_00367873 predicted 367
5 SASI_Hs01_00081148 predicted 540
6 SASI_Hs01_00081149 predicted 364
7 SASI_Hs01_00081150 predicted 1542
8 SASI_Hs01_00081151 predicted 743
9 SASI_Hs01_00081152 predicted 671
10 SASI_Hs01_00081153 predicted 2138
11 SASI_Hs01_00081145 predicted 1624
12 SASI_Hs01_00081146 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064670 predicted 448
2 SASI_Hs02_00367874 predicted 841
3 SASI_Hs01_00064673 predicted 460
4 SASI_Hs02_00367875 predicted 366
5 SASI_Hs01_00064674 predicted 532
6 SASI_Hs01_00064675 predicted 360
7 SASI_Hs01_00064676 predicted 1647
8 SASI_Hs01_00064677 predicted 745
9 SASI_Hs01_00064678 predicted 664
10 SASI_Hs01_00064679 predicted 2252
11 SASI_Hs01_00064671 predicted 1728
12 SASI_Hs01_00064672 predicted 446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152059 predicted 449
2 SASI_Hs01_00152060 predicted 1657
3 SASI_Hs01_00152061 predicted 448
4 SASI_Hs01_00152062 predicted 465
5 SASI_Hs01_00152063 predicted 535
6 SASI_Hs01_00152064 predicted 374
7 SASI_Hs01_00152065 predicted 1588
8 SASI_Hs01_00152066 predicted 747
9 SASI_Hs01_00152067 predicted 673
10 SASI_Hs01_00152068 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205118 predicted 449
2 SASI_Hs02_00367876 predicted 842
3 SASI_Hs01_00205121 predicted 452
4 SASI_Hs02_00367877 predicted 364
5 SASI_Hs01_00205122 predicted 533
6 SASI_Hs01_00205123 predicted 362
7 SASI_Hs01_00205124 predicted 1499
8 SASI_Hs01_00205125 predicted 744
9 SASI_Hs01_00205126 predicted 668
10 SASI_Hs01_00205127 predicted 2096
11 SASI_Hs01_00205119 predicted 1575
12 SASI_Hs01_00205120 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133605 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039387 predicted 215
2 SASI_Rn02_00267826 predicted 223
3 SASI_Rn02_00267827 predicted 215
4 SASI_Rn01_00039388 predicted 452
5 SASI_Rn01_00039390 predicted 343
6 SASI_Rn01_00039391 predicted 1124
7 SASI_Rn01_00039393 predicted 787
8 SASI_Rn01_00039394 predicted 285
9 SASI_Rn01_00039395 predicted 1419
10 SASI_Rn01_00039396 predicted 1047
11 SASI_Rn01_00039389 predicted 914
12 SASI_Rn01_00039392 predicted 870
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289844 predicted 300
2 SASI_Mm01_00044903 predicted 1613
3 SASI_Mm01_00044904 predicted 311
4 SASI_Mm01_00044905 predicted 309
5 SASI_Mm01_00044906 predicted 539
6 SASI_Mm01_00044907 predicted 1530
7 SASI_Mm01_00044909 predicted 618
8 SASI_Mm01_00044910 predicted 331
9 SASI_Mm01_00044911 predicted 574
10 SASI_Mm01_00044912 predicted 341
11 SASI_Mm01_00044908 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039139 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289845 predicted 306
2 SASI_Mm01_00080845 predicted 1544
3 SASI_Mm01_00080846 predicted 309
4 SASI_Mm01_00080847 predicted 303
5 SASI_Mm01_00080848 predicted 536
6 SASI_Mm01_00080849 predicted 1453
7 SASI_Mm01_00080851 predicted 610
8 SASI_Mm01_00080852 predicted 328
9 SASI_Mm01_00080853 predicted 576
10 SASI_Mm01_00080854 predicted 343
11 SASI_Mm01_00080850 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348921 predicted 300
2 SASI_Mm01_00164945 predicted 1649
3 SASI_Mm01_00164946 predicted 306
4 SASI_Mm01_00164947 predicted 307
5 SASI_Mm01_00164948 predicted 533
6 SASI_Mm01_00164949 predicted 1564
7 SASI_Mm01_00164951 predicted 610
8 SASI_Mm01_00164952 predicted 328
9 SASI_Mm01_00164953 predicted 577
10 SASI_Mm01_00164954 predicted 341
11 SASI_Mm01_00164950 predicted 1702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001222
VALIDATED
CAMK2G MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II gamma
Human
24 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-450s21c1
Sequence:GTACCGGGCAGATGCCAGCCACTGTATACTCGAGTATACAGTGGCTGGCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1211s21c1
Sequence:GTACCGGACAGGAGATCATTAAGATTACCTCGAGGTAATCTTAATGATCTCCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1042s21c1
Sequence:GTACCGGTGCTTGTCTCCAGGAACTTCTCTCGAGAGAAGTTCCTGGAGACAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1135s21c1
Sequence:GTACCGGACGCTACAGATGGGATCAAGGCTCGAGCCTTGATCCCATCTGTAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1367s21c1
Sequence:GTACCGGTGAGAATCTCCTGTCCAAGAACTCGAGTTCTTGGACAGGAGATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-370s21c1
Sequence:GTACCGGGGTTTCACTACCTCGTGTTTGCTCGAGCAAACACGAGGTAGTGAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1341s21c1
Sequence:GTACCGGGGGATGGATTTCCATAAGTTTCTCGAGAAACTTATGGAAATCCATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-315s21c1
Sequence:GTACCGGCGACTTCTGAAACATCCAAACCTCGAGGTTTGGATGTTTCAGAAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-175s21c1
Sequence:GTACCGGAGCTTGGCAAGGGTGCTTTCTCTCGAGAGAAAGCACCCTTGCCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-985s21c1
Sequence:GTACCGGAGTGTTTGCGCAAGTTCAATGCTCGAGCATTGAACTTGCGCAAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1545s21c1
Sequence:GTACCGGGATGGCAAGTGGCTCAATGTCCTCGAGGACATTGAGCCACTTGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1695s21c1
Sequence:GTACCGGTCCTGTTTGTTTGAGGTTTAACTCGAGTTAAACCTCAAACAAACAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1397s21c1
Sequence:GTACCGGTATCCATACCACCATCCTAAACTCGAGTTTAGGATGGTGGTATGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-473s21c1
Sequence:GTACCGGTCAGATTCTGGAGAGTGTTAACTCGAGTTAACACTCTCCAGAATCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1267s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-293s21c1
Sequence:CCGGAGAACGTGAGGCTCGGATATGCTCGAGCATATCCGAGCCTCACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-769s21c1
Sequence:GTACCGGAGGATCAGCACAAGCTGTATCCTCGAGGATACAGCTTGTGCTGATCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001222.2-303s1c1
Sequence:CCGGGCTCGGATATGTCGACTTCTGCTCGAGCAGAAGTCGACATATCCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001222.2-1696s1c1
Sequence:CCGGCCTGTTTGTTTGAGGTTTAAACTCGAGTTTAAACCTCAAACAAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-1384s1c1
Sequence:CCGGAGAACAGCAAGCCTATCCATACTCGAGTATGGATAGGCTTGCTGTTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-379s1c1
Sequence:CCGGACCTCGTGTTTGACCTTGTTACTCGAGTAACAAGGTCAAACACGAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-2251s1c1
Sequence:CCGGCGTTGCTGTACTGTCTTGTTTCTCGAGAAACAAGACAGTACAGCAACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-1130s1c1
Sequence:CCGGACACAACGCTACAGATGGGATCTCGAGATCCCATCTGTAGCGTTGTGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-279s1c1
Sequence:CCGGGATCACCAGAAACTAGAACGTCTCGAGACGTTCTAGTTTCTGGTGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001222
VALIDATED
CAMK2G MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II gamma
Human
24 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-450s21c1
Sequence:GTACCGGGCAGATGCCAGCCACTGTATACTCGAGTATACAGTGGCTGGCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1211s21c1
Sequence:GTACCGGACAGGAGATCATTAAGATTACCTCGAGGTAATCTTAATGATCTCCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1042s21c1
Sequence:GTACCGGTGCTTGTCTCCAGGAACTTCTCTCGAGAGAAGTTCCTGGAGACAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1135s21c1
Sequence:GTACCGGACGCTACAGATGGGATCAAGGCTCGAGCCTTGATCCCATCTGTAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1367s21c1
Sequence:GTACCGGTGAGAATCTCCTGTCCAAGAACTCGAGTTCTTGGACAGGAGATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-370s21c1
Sequence:GTACCGGGGTTTCACTACCTCGTGTTTGCTCGAGCAAACACGAGGTAGTGAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1341s21c1
Sequence:GTACCGGGGGATGGATTTCCATAAGTTTCTCGAGAAACTTATGGAAATCCATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-315s21c1
Sequence:GTACCGGCGACTTCTGAAACATCCAAACCTCGAGGTTTGGATGTTTCAGAAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-175s21c1
Sequence:GTACCGGAGCTTGGCAAGGGTGCTTTCTCTCGAGAGAAAGCACCCTTGCCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-985s21c1
Sequence:GTACCGGAGTGTTTGCGCAAGTTCAATGCTCGAGCATTGAACTTGCGCAAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1545s21c1
Sequence:GTACCGGGATGGCAAGTGGCTCAATGTCCTCGAGGACATTGAGCCACTTGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1695s21c1
Sequence:GTACCGGTCCTGTTTGTTTGAGGTTTAACTCGAGTTAAACCTCAAACAAACAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1397s21c1
Sequence:GTACCGGTATCCATACCACCATCCTAAACTCGAGTTTAGGATGGTGGTATGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-473s21c1
Sequence:GTACCGGTCAGATTCTGGAGAGTGTTAACTCGAGTTAACACTCTCCAGAATCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1267s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-293s21c1
Sequence:CCGGAGAACGTGAGGCTCGGATATGCTCGAGCATATCCGAGCCTCACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-769s21c1
Sequence:GTACCGGAGGATCAGCACAAGCTGTATCCTCGAGGATACAGCTTGTGCTGATCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001222.2-303s1c1
Sequence:CCGGGCTCGGATATGTCGACTTCTGCTCGAGCAGAAGTCGACATATCCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001222.2-1696s1c1
Sequence:CCGGCCTGTTTGTTTGAGGTTTAAACTCGAGTTTAAACCTCAAACAAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-1384s1c1
Sequence:CCGGAGAACAGCAAGCCTATCCATACTCGAGTATGGATAGGCTTGCTGTTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-379s1c1
Sequence:CCGGACCTCGTGTTTGACCTTGTTACTCGAGTAACAAGGTCAAACACGAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-2251s1c1
Sequence:CCGGCGTTGCTGTACTGTCTTGTTTCTCGAGAAACAAGACAGTACAGCAACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-1130s1c1
Sequence:CCGGACACAACGCTACAGATGGGATCTCGAGATCCCATCTGTAGCGTTGTGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-279s1c1
Sequence:CCGGGATCACCAGAAACTAGAACGTCTCGAGACGTTCTAGTTTCTGGTGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001222
VALIDATED
CAMK2G MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II gamma
Human
24 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-450s21c1
Sequence:GTACCGGGCAGATGCCAGCCACTGTATACTCGAGTATACAGTGGCTGGCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1211s21c1
Sequence:GTACCGGACAGGAGATCATTAAGATTACCTCGAGGTAATCTTAATGATCTCCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1042s21c1
Sequence:GTACCGGTGCTTGTCTCCAGGAACTTCTCTCGAGAGAAGTTCCTGGAGACAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1135s21c1
Sequence:GTACCGGACGCTACAGATGGGATCAAGGCTCGAGCCTTGATCCCATCTGTAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1367s21c1
Sequence:GTACCGGTGAGAATCTCCTGTCCAAGAACTCGAGTTCTTGGACAGGAGATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-370s21c1
Sequence:GTACCGGGGTTTCACTACCTCGTGTTTGCTCGAGCAAACACGAGGTAGTGAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1341s21c1
Sequence:GTACCGGGGGATGGATTTCCATAAGTTTCTCGAGAAACTTATGGAAATCCATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-315s21c1
Sequence:GTACCGGCGACTTCTGAAACATCCAAACCTCGAGGTTTGGATGTTTCAGAAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-175s21c1
Sequence:GTACCGGAGCTTGGCAAGGGTGCTTTCTCTCGAGAGAAAGCACCCTTGCCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-985s21c1
Sequence:GTACCGGAGTGTTTGCGCAAGTTCAATGCTCGAGCATTGAACTTGCGCAAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1545s21c1
Sequence:GTACCGGGATGGCAAGTGGCTCAATGTCCTCGAGGACATTGAGCCACTTGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217949    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1695s21c1
Sequence:GTACCGGTCCTGTTTGTTTGAGGTTTAACTCGAGTTAAACCTCAAACAAACAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-1397s21c1
Sequence:GTACCGGTATCCATACCACCATCCTAAACTCGAGTTTAGGATGGTGGTATGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-473s21c1
Sequence:GTACCGGTCAGATTCTGGAGAGTGTTAACTCGAGTTAACACTCTCCAGAATCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-1267s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_001222.2-293s21c1
Sequence:CCGGAGAACGTGAGGCTCGGATATGCTCGAGCATATCCGAGCCTCACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001222.2-769s21c1
Sequence:GTACCGGAGGATCAGCACAAGCTGTATCCTCGAGGATACAGCTTGTGCTGATCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001222.2-303s1c1
Sequence:CCGGGCTCGGATATGTCGACTTCTGCTCGAGCAGAAGTCGACATATCCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194892    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001222.2-1696s1c1
Sequence:CCGGCCTGTTTGTTTGAGGTTTAAACTCGAGTTTAAACCTCAAACAAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-1384s1c1
Sequence:CCGGAGAACAGCAAGCCTATCCATACTCGAGTATGGATAGGCTTGCTGTTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-379s1c1
Sequence:CCGGACCTCGTGTTTGACCTTGTTACTCGAGTAACAAGGTCAAACACGAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000476    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-2251s1c1
Sequence:CCGGCGTTGCTGTACTGTCTTGTTTCTCGAGAAACAAGACAGTACAGCAACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001222.x-1130s1c1
Sequence:CCGGACACAACGCTACAGATGGGATCTCGAGATCCCATCTGTAGCGTTGTGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_001222.x-279s1c1
Sequence:CCGGGATCACCAGAAACTAGAACGTCTCGAGACGTTCTAGTTTCTGGTGATCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178597
VALIDATED
CAMK2G MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-984s21c1
Sequence:CCGGGGTAGAGTGCTTACGCAAATTCTCGAGAATTTGCGTAAGCACTCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1373s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1550s21c1
Sequence:CCGGACGCAGCTTGCATCGCCTATACTCGAGTATAGGCGATGCAAGCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-545s21c1
Sequence:CCGGACTTGCTGCTGGCGAGTAAATCTCGAGATTTACTCGCCAGCAGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-221s1c1
Sequence:CCGGGCCCGAGATCATCAGAAACTACTCGAGTAGTTTCTGATGATCTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-614s1c1
Sequence:CCGGCCTGAGGTCTTGAGGAAAGATCTCGAGATCTTTCCTCAAGACCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-716s1c1
Sequence:CCGGGAGGATCAGCACAAGCTGTATCTCGAGATACAGCTTGTGCTGATCCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-174s1c1
Sequence:CCGGCTACGCAGGAATATGCTGCAACTCGAGTTGCAGCATATTCCTGCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-1054s1c1
Sequence:CCGGCAAGCCACAGAGCAACAACAACTCGAGTTGTTGTTGCTCTGTGGCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178597
VALIDATED
CAMK2G MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-984s21c1
Sequence:CCGGGGTAGAGTGCTTACGCAAATTCTCGAGAATTTGCGTAAGCACTCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1373s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1550s21c1
Sequence:CCGGACGCAGCTTGCATCGCCTATACTCGAGTATAGGCGATGCAAGCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-545s21c1
Sequence:CCGGACTTGCTGCTGGCGAGTAAATCTCGAGATTTACTCGCCAGCAGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-221s1c1
Sequence:CCGGGCCCGAGATCATCAGAAACTACTCGAGTAGTTTCTGATGATCTCGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-614s1c1
Sequence:CCGGCCTGAGGTCTTGAGGAAAGATCTCGAGATCTTTCCTCAAGACCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-716s1c1
Sequence:CCGGGAGGATCAGCACAAGCTGTATCTCGAGATACAGCTTGTGCTGATCCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-174s1c1
Sequence:CCGGCTACGCAGGAATATGCTGCAACTCGAGTTGCAGCATATTCCTGCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-1054s1c1
Sequence:CCGGCAAGCCACAGAGCAACAACAACTCGAGTTGTTGTTGCTCTGTGGCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178597
VALIDATED
CAMK2G MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-984s21c1
Sequence:CCGGGGTAGAGTGCTTACGCAAATTCTCGAGAATTTGCGTAAGCACTCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1373s21c1
Sequence:CCGGTTGAGGCCTACACGAAGATTTCTCGAGAAATCTTCGTGTAGGCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-1550s21c1
Sequence:CCGGACGCAGCTTGCATCGCCTATACTCGAGTATAGGCGATGCAAGCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178597.4-545s21c1
Sequence:CCGGACTTGCTGCTGGCGAGTAAATCTCGAGATTTACTCGCCAGCAGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-221s1c1
Sequence:CCGGGCCCGAGATCATCAGAAACTACTCGAGTAGTTTCTGATGATCTCGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-614s1c1
Sequence:CCGGCCTGAGGTCTTGAGGAAAGATCTCGAGATCTTTCCTCAAGACCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_178597.2-716s1c1
Sequence:CCGGGAGGATCAGCACAAGCTGTATCTCGAGATACAGCTTGTGCTGATCCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-174s1c1
Sequence:CCGGCTACGCAGGAATATGCTGCAACTCGAGTTGCAGCATATTCCTGCGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178597.2-1054s1c1
Sequence:CCGGCAAGCCACAGAGCAACAACAACTCGAGTTGTTGTTGCTCTGTGGCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)