EMAIL THIS PAGE TO A FRIEND

CAMK2N1

calcium/calmodulin-dependent protein kinase II inhibitor 1

169 Gene Product Result for
Synonyms: PRO1489 RP11-401M16.1
UniProtKB ID: Q7Z7J9
Gene ID:
Mouse(66259) calcium/calmodulin-dependent protein kinase II inhibitor 1
Rat(287005) calcium/calmodulin-dependent protein kinase II inhibitor 1
cow(616227) calcium/calmodulin-dependent protein kinase II inhibitor 1
domestic cat(101092279) calcium/calmodulin-dependent protein kinase II inhibitor 1
sheep(101102884) calcium/calmodulin-dependent protein kinase II inhibitor 1
naked mole-rat(101712739) calcium/calmodulin-dependent protein kinase II inhibitor 1
domestic guinea pig(100721338) calcium/calmodulin-dependent protein kinase II inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302411 ANTI-CAMK2N1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018584 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018584 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018584 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018584 Rosetta Predictions human pricing
NM_173337 Rosetta Predictions rat pricing
NM_025451 Rosetta Predictions mouse pricing
XM_890229 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018584 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014824 predicted 1189
2 SASI_Hs02_00352120 predicted 1517
3 SASI_Hs02_00352121 predicted 1038
4 SASI_Hs02_00352122 predicted 1519
5 SASI_Hs01_00014827 predicted 1009
6 SASI_Hs02_00352123 predicted 1533
7 SASI_Hs01_00014828 predicted 1096
8 SASI_Hs01_00014829 predicted 1129
9 SASI_Hs01_00014832 predicted 1192
10 SASI_Hs02_00352124 predicted 1218
11 SASI_Hs01_00014825 predicted 620
12 SASI_Hs01_00014826 predicted 455
13 SASI_Hs01_00014830 predicted 560
14 SASI_Hs01_00014831 predicted 561
15 SASI_Hs01_00014833 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065370 predicted 163
2 SASI_Rn01_00065371 predicted 223
3 SASI_Rn01_00065372 predicted 163
4 SASI_Rn01_00065373 predicted 289
5 SASI_Rn01_00065374 predicted 353
6 SASI_Rn01_00065375 predicted 326
7 SASI_Rn02_00269469 predicted 321
8 SASI_Rn01_00065376 predicted 332
9 SASI_Rn01_00065377 predicted 378
10 SASI_Rn01_00065378 predicted 190
11 SASI_Rn01_00065379 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328280 predicted 318
2 SASI_Mm02_00328281 predicted 395
3 SASI_Mm02_00328282 predicted 184
4 SASI_Mm02_00328283 predicted 657
5 SASI_Mm02_00328284 predicted 718
6 SASI_Mm02_00328285 predicted 199
7 SASI_Mm02_00328286 predicted 768
8 SASI_Mm02_00328287 predicted 366
9 SASI_Mm02_00328288 predicted 700
10 SASI_Mm02_00328289 predicted 385
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890229 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207870 predicted 929
2 SASI_Mm01_00207871 predicted 1002
3 SASI_Mm01_00207872 predicted 793
4 SASI_Mm01_00207873 predicted 1264
5 SASI_Mm01_00207874 predicted 1320
6 SASI_Mm01_00207875 predicted 85
7 SASI_Mm01_00207876 predicted 1372
8 SASI_Mm01_00207877 predicted 976
9 SASI_Mm01_00207878 predicted 1304
10 SASI_Mm01_00207879 predicted 993
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018584
VALIDATED
CAMK2N1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II inhibitor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-563s1c1
Sequence:CCGGCGGGTTGTTATTGAAGATGATCTCGAGATCATCTTCAATAACAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-584s1c1
Sequence:CCGGAGGATTGATGACGTGCTGAAACTCGAGTTTCAGCACGTCATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018584.4-615s1c1
Sequence:CCGGACAAGGCACCTCCTGGTGTCTCTCGAGAGACACCAGGAGGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-553s1c1
Sequence:CCGGCCGGAGCAAGCGGGTTGTTATCTCGAGATAACAACCCGCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-469s1c1
Sequence:CCGGGATCTTCTCCTGCCGCCTGCACTCGAGTGCAGGCGGCAGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-493s1c1
Sequence:CCGGCACCAACAACTTCTTCGGCGCCTCGAGGCGCCGAAGAAGTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-673s1c1
Sequence:CCGGGAACGGCGGTAACAGTTATTGCTCGAGCAATAACTGTTACCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1062s1c1
Sequence:CCGGATATGACCGACAAGGCACCTCCTCGAGGAGGTGCCTTGTCGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018584.5-1429s1c1
Sequence:CCGGCGGTGAATATTGCGCAATTATCTCGAGATAATTGCGCAATATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1027s1c1
Sequence:CCGGTATTGAAGATGATAGGATTGACTCGAGTCAATCCTATCATCTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018584
VALIDATED
CAMK2N1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II inhibitor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-563s1c1
Sequence:CCGGCGGGTTGTTATTGAAGATGATCTCGAGATCATCTTCAATAACAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-584s1c1
Sequence:CCGGAGGATTGATGACGTGCTGAAACTCGAGTTTCAGCACGTCATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018584.4-615s1c1
Sequence:CCGGACAAGGCACCTCCTGGTGTCTCTCGAGAGACACCAGGAGGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-553s1c1
Sequence:CCGGCCGGAGCAAGCGGGTTGTTATCTCGAGATAACAACCCGCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-469s1c1
Sequence:CCGGGATCTTCTCCTGCCGCCTGCACTCGAGTGCAGGCGGCAGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-493s1c1
Sequence:CCGGCACCAACAACTTCTTCGGCGCCTCGAGGCGCCGAAGAAGTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-673s1c1
Sequence:CCGGGAACGGCGGTAACAGTTATTGCTCGAGCAATAACTGTTACCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1062s1c1
Sequence:CCGGATATGACCGACAAGGCACCTCCTCGAGGAGGTGCCTTGTCGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018584.5-1429s1c1
Sequence:CCGGCGGTGAATATTGCGCAATTATCTCGAGATAATTGCGCAATATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1027s1c1
Sequence:CCGGTATTGAAGATGATAGGATTGACTCGAGTCAATCCTATCATCTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018584
VALIDATED
CAMK2N1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II inhibitor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-563s1c1
Sequence:CCGGCGGGTTGTTATTGAAGATGATCTCGAGATCATCTTCAATAACAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-584s1c1
Sequence:CCGGAGGATTGATGACGTGCTGAAACTCGAGTTTCAGCACGTCATCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018584.4-615s1c1
Sequence:CCGGACAAGGCACCTCCTGGTGTCTCTCGAGAGACACCAGGAGGTGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018584.4-553s1c1
Sequence:CCGGCCGGAGCAAGCGGGTTGTTATCTCGAGATAACAACCCGCTTGCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-469s1c1
Sequence:CCGGGATCTTCTCCTGCCGCCTGCACTCGAGTGCAGGCGGCAGGAGAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199309    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-493s1c1
Sequence:CCGGCACCAACAACTTCTTCGGCGCCTCGAGGCGCCGAAGAAGTTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197259    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.4-673s1c1
Sequence:CCGGGAACGGCGGTAACAGTTATTGCTCGAGCAATAACTGTTACCGCCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1062s1c1
Sequence:CCGGATATGACCGACAAGGCACCTCCTCGAGGAGGTGCCTTGTCGGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219773    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018584.5-1429s1c1
Sequence:CCGGCGGTGAATATTGCGCAATTATCTCGAGATAATTGCGCAATATTCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219771    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018584.5-1027s1c1
Sequence:CCGGTATTGAAGATGATAGGATTGACTCGAGTCAATCCTATCATCTTCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025451
VALIDATED
CAMK2N1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II inhibitor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-128s21c1
Sequence:CCGGGGACACCAACAACTTCTTCGGCTCGAGCCGAAGAAGTTGTTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-393s21c1
Sequence:CCGGGCTTGCTACCTGCGATGAAATCTCGAGATTTCATCGCAGGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-192s21c1
Sequence:CCGGCGGAGCAAGCGCGTTGTTATTCTCGAGAATAACAACGCGCTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-221s21c1
Sequence:CCGGTAGGATTGATGACGTGCTGAACTCGAGTTCAGCACGTCATCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-203s21c1
Sequence:CCGGCGTTGTTATTGAAGATGATAGCTCGAGCTATCATCTTCAATAACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025451
VALIDATED
CAMK2N1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II inhibitor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-128s21c1
Sequence:CCGGGGACACCAACAACTTCTTCGGCTCGAGCCGAAGAAGTTGTTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-393s21c1
Sequence:CCGGGCTTGCTACCTGCGATGAAATCTCGAGATTTCATCGCAGGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-192s21c1
Sequence:CCGGCGGAGCAAGCGCGTTGTTATTCTCGAGAATAACAACGCGCTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-221s21c1
Sequence:CCGGTAGGATTGATGACGTGCTGAACTCGAGTTCAGCACGTCATCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-203s21c1
Sequence:CCGGCGTTGTTATTGAAGATGATAGCTCGAGCTATCATCTTCAATAACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025451
VALIDATED
CAMK2N1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II inhibitor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-128s21c1
Sequence:CCGGGGACACCAACAACTTCTTCGGCTCGAGCCGAAGAAGTTGTTGGTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-393s21c1
Sequence:CCGGGCTTGCTACCTGCGATGAAATCTCGAGATTTCATCGCAGGTAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-192s21c1
Sequence:CCGGCGGAGCAAGCGCGTTGTTATTCTCGAGAATAACAACGCGCTTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-221s21c1
Sequence:CCGGTAGGATTGATGACGTGCTGAACTCGAGTTCAGCACGTCATCAATCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025451.2-203s21c1
Sequence:CCGGCGTTGTTATTGAAGATGATAGCTCGAGCTATCATCTTCAATAACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks