EMAIL THIS PAGE TO A FRIEND

CAMK2N2

calcium/calmodulin-dependent protein kinase II inhibitor 2

96 Gene Product Result for
Synonyms: CAM-KIIN CAMKIIN
UniProtKB ID: Q96S95
Gene ID:
Human(94032) Summary: This gene encodes a protein that is highly similar to the rat CaM-KII inhibitory protein, an inhibitor of calcium/calmodulin-dependent protein kinase II (CAMKII). CAMKII regulates numerous physiological functions, including neuronal synaptic plasticity through the phosphorylation of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid-type glutamate (AMPA) receptors. Studies of the similar protein in rat suggest that this protein may function as a negative regulator of CaM-KII and may act to inhibit the phosphorylation of AMPA receptors. [provided by RefSeq, Jul 2008]
Mouse(73047) calcium/calmodulin-dependent protein kinase II inhibitor 2
Rat(59314) calcium/calmodulin-dependent protein kinase II inhibitor 2
Zebrafish(436915) calcium/calmodulin-dependent protein kinase II inhibitor 2
dog(607194) calcium/calmodulin-dependent protein kinase II inhibitor 2
cow(614606) calcium/calmodulin-dependent protein kinase II inhibitor 2
naked mole-rat(101714073) calcium/calmodulin-dependent protein kinase II inhibitor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033259 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033259 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033259 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU161021 MISSION® esiRNA esiRNA targeting mouse Camk2n2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033259 Rosetta Predictions human pricing
NM_021678 Rosetta Predictions rat pricing
NM_028420 Rosetta Predictions mouse pricing
XM_990809 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088264 predicted 823
2 SASI_Hs01_00088265 predicted 361
3 SASI_Hs01_00088266 predicted 351
4 SASI_Hs02_00361056 predicted 960
5 SASI_Hs01_00088267 predicted 1238
6 SASI_Hs01_00088268 predicted 1292
7 SASI_Hs01_00088269 predicted 1236
8 SASI_Hs01_00088270 predicted 1261
9 SASI_Hs01_00088272 predicted 1326
10 SASI_Hs01_00088273 predicted 932
11 SASI_Hs01_00088271 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038847 predicted 257
2 SASI_Rn01_00038848 predicted 229
3 SASI_Rn01_00038849 predicted 240
4 SASI_Rn01_00038850 predicted 267
5 SASI_Rn01_00038851 predicted 225
6 SASI_Rn01_00038852 predicted 142
7 SASI_Rn01_00038853 predicted 220
8 SASI_Rn01_00038854 predicted 250
9 SASI_Rn01_00038855 predicted 303
10 SASI_Rn01_00038856 predicted 137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333827 predicted 254
2 SASI_Mm02_00333828 predicted 737
3 SASI_Mm02_00333829 predicted 222
4 SASI_Mm02_00333830 predicted 244
5 SASI_Mm02_00333831 predicted 270
6 SASI_Mm02_00333832 predicted 227
7 SASI_Mm02_00333833 predicted 772
8 SASI_Mm02_00333834 predicted 565
9 SASI_Mm02_00333835 predicted 730
10 SASI_Mm02_00333836 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_990809 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276651 predicted 737
2 SASI_Mm01_00276652 predicted 782
3 SASI_Mm01_00276653 predicted 774
4 SASI_Mm01_00276654 predicted 740
5 SASI_Mm01_00276655 predicted 785
6 SASI_Mm01_00276656 predicted 798
7 SASI_Mm01_00276657 predicted 261
8 SASI_Mm01_00276658 predicted 233
9 SASI_Mm01_00276659 predicted 247
10 SASI_Mm01_00276660 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028420
CAMK2N2 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II inhibitor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-246s21c1
Sequence:CCGGCAAGAGAGTGGTGATCGAGGACTCGAGTCCTCGATCACCACTCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-270s21c1
Sequence:CCGGCCGGATAGACGACGTGCTGAACTCGAGTTCAGCACGTCGTCTATCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-142s21c1
Sequence:CCGGGAAGGTTCCGACCTCTCTTTCCTCGAGGAAAGAGAGGTCGGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028420.2-738s21c1
Sequence:CCGGGGAGGTTTGGCTGCATATTTGCTCGAGCAAATATGCAGCCAAACCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-257s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028420
CAMK2N2 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II inhibitor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-246s21c1
Sequence:CCGGCAAGAGAGTGGTGATCGAGGACTCGAGTCCTCGATCACCACTCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-270s21c1
Sequence:CCGGCCGGATAGACGACGTGCTGAACTCGAGTTCAGCACGTCGTCTATCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-142s21c1
Sequence:CCGGGAAGGTTCCGACCTCTCTTTCCTCGAGGAAAGAGAGGTCGGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028420.2-738s21c1
Sequence:CCGGGGAGGTTTGGCTGCATATTTGCTCGAGCAAATATGCAGCCAAACCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-257s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028420
CAMK2N2 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II inhibitor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-246s21c1
Sequence:CCGGCAAGAGAGTGGTGATCGAGGACTCGAGTCCTCGATCACCACTCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-270s21c1
Sequence:CCGGCCGGATAGACGACGTGCTGAACTCGAGTTCAGCACGTCGTCTATCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-142s21c1
Sequence:CCGGGAAGGTTCCGACCTCTCTTTCCTCGAGGAAAGAGAGGTCGGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028420.2-738s21c1
Sequence:CCGGGGAGGTTTGGCTGCATATTTGCTCGAGCAAATATGCAGCCAAACCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028420.2-257s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033259
CAMK2N2 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase II inhibitor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1172s21c1
Sequence:CCGGCCAAGGGCCCAGATCCGATTTCTCGAGAAATCGGATCTGGGCCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1054s21c1
Sequence:CCGGGTTGAGGCTGGGATGAGACAACTCGAGTTGTCTCATCCCAGCCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-831s21c1
Sequence:CCGGTGCGTACTTGCATGAGCTTTCCTCGAGGAAAGCTCATGCAAGTACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-932s21c1
Sequence:CCGGAGGGACTTCCTCAGCACATTTCTCGAGAAATGTGCTGAGGAAGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033259.2-351s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033259
CAMK2N2 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase II inhibitor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1172s21c1
Sequence:CCGGCCAAGGGCCCAGATCCGATTTCTCGAGAAATCGGATCTGGGCCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1054s21c1
Sequence:CCGGGTTGAGGCTGGGATGAGACAACTCGAGTTGTCTCATCCCAGCCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-831s21c1
Sequence:CCGGTGCGTACTTGCATGAGCTTTCCTCGAGGAAAGCTCATGCAAGTACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-932s21c1
Sequence:CCGGAGGGACTTCCTCAGCACATTTCTCGAGAAATGTGCTGAGGAAGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033259.2-351s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033259
CAMK2N2 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase II inhibitor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1172s21c1
Sequence:CCGGCCAAGGGCCCAGATCCGATTTCTCGAGAAATCGGATCTGGGCCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-1054s21c1
Sequence:CCGGGTTGAGGCTGGGATGAGACAACTCGAGTTGTCTCATCCCAGCCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243331    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-831s21c1
Sequence:CCGGTGCGTACTTGCATGAGCTTTCCTCGAGGAAAGCTCATGCAAGTACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243329    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033259.2-932s21c1
Sequence:CCGGAGGGACTTCCTCAGCACATTTCTCGAGAAATGTGCTGAGGAAGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033259.2-351s21c1
Sequence:CCGGTGATCGAGGATGACCGGATAGCTCGAGCTATCCGGTCATCCTCGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)