EMAIL THIS PAGE TO A FRIEND

CAMKK1

calcium/calmodulin-dependent protein kinase kinase 1, alpha

233 Gene Product Result for
Synonyms: CAMKKA
UniProtKB ID: Q8N5S9, Q9BQH3
Gene ID:
Human(84254) Summary: The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. This protein plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade. Three transcript variants encoding two distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(55984) calcium/calmodulin-dependent protein kinase kinase 1, alpha
Rat(60341) calcium/calmodulin-dependent protein kinase kinase 1, alpha
Zebrafish(541526) calcium/calmodulin-dependent protein kinase kinase 1, alpha
cow(510260) calcium/calmodulin-dependent protein kinase kinase 1, alpha
Horse(100060657) calcium/calmodulin-dependent protein kinase kinase 1, alpha
domestic cat(101091320) calcium/calmodulin-dependent protein kinase kinase 1, alpha
dog(611124) calcium/calmodulin-dependent protein kinase kinase 1, alpha
chicken(771003) calcium/calmodulin-dependent protein kinase kinase 1, alpha
sheep(101102157) calcium/calmodulin-dependent protein kinase kinase 1, alpha
Domestic Rabbit(100350843) calcium/calmodulin-dependent protein kinase kinase 1, alpha
domestic guinea pig(100727495) calcium/calmodulin-dependent protein kinase kinase 1, alpha
naked mole-rat(101723518) calcium/calmodulin-dependent protein kinase kinase 1, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172207 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172207 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172207 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032294 Rosetta Predictions human pricing
NM_172206 Rosetta Predictions human pricing
NM_172207 Rosetta Predictions human pricing
NM_031662 Rosetta Predictions rat pricing
NM_018883 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359629 predicted 1244
2 SASI_Hs02_00359630 predicted 1168
3 SASI_Hs02_00359631 predicted 1315
4 SASI_Hs01_00186758 predicted 558
5 SASI_Hs02_00359632 predicted 1195
6 SASI_Hs01_00186759 predicted 343
7 SASI_Hs01_00186760 predicted 383
8 SASI_Hs02_00359633 predicted 1108
9 SASI_Hs01_00186761 predicted 603
10 SASI_Hs01_00186762 predicted 532
11 SASI_Hs01_00186757 predicted 595
12 SASI_Hs01_00186763 predicted 606
13 SASI_Hs01_00186764 predicted 591
14 SASI_Hs01_00186765 predicted 356
15 SASI_Hs01_00186766 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367905 predicted 1182
2 SASI_Hs02_00367906 predicted 1111
3 SASI_Hs02_00367907 predicted 1259
4 SASI_Hs01_00218762 predicted 509
5 SASI_Hs02_00367908 predicted 1137
6 SASI_Hs01_00218763 predicted 288
7 SASI_Hs01_00218764 predicted 330
8 SASI_Hs02_00367909 predicted 1052
9 SASI_Hs01_00218765 predicted 552
10 SASI_Hs01_00218766 predicted 483
11 SASI_Hs01_00218761 predicted 550
12 SASI_Hs01_00218767 predicted 548
13 SASI_Hs01_00218768 predicted 534
14 SASI_Hs01_00218769 predicted 298
15 SASI_Hs01_00218770 predicted 538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367910 predicted 1352
2 SASI_Hs02_00367911 predicted 1278
3 SASI_Hs02_00367912 predicted 1433
4 SASI_Hs01_00074404 predicted 561
5 SASI_Hs02_00367913 predicted 1308
6 SASI_Hs01_00074405 predicted 349
7 SASI_Hs01_00074406 predicted 389
8 SASI_Hs02_00367914 predicted 1219
9 SASI_Hs01_00074407 predicted 602
10 SASI_Hs01_00074408 predicted 532
11 SASI_Hs01_00074403 predicted 597
12 SASI_Hs01_00074409 predicted 598
13 SASI_Hs01_00074410 predicted 583
14 SASI_Hs01_00074411 predicted 355
15 SASI_Hs01_00074412 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093489 predicted 1271
2 SASI_Rn01_00093490 predicted 349
3 SASI_Rn01_00093491 predicted 766
4 SASI_Rn01_00093492 predicted 1532
5 SASI_Rn01_00093493 predicted 716
6 SASI_Rn02_00265002 predicted 1275
7 SASI_Rn02_00265003 predicted 566
8 SASI_Rn01_00093496 predicted 557
9 SASI_Rn01_00093497 predicted 1150
10 SASI_Rn01_00093498 predicted 722
11 SASI_Rn01_00093494 predicted 573
12 SASI_Rn01_00093495 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324291 predicted 217
2 SASI_Mm02_00324292 predicted 412
3 SASI_Mm01_00133425 predicted 978
4 SASI_Mm01_00133426 predicted 622
5 SASI_Mm01_00133428 predicted 617
6 SASI_Mm01_00133429 predicted 1115
7 SASI_Mm02_00324293 predicted 222
8 SASI_Mm02_00324294 predicted 754
9 SASI_Mm02_00324295 predicted 608
10 SASI_Mm02_00324296 predicted 1518
11 SASI_Mm01_00133422 predicted 1138
12 SASI_Mm01_00133423 predicted 1137
13 SASI_Mm01_00133424 predicted 2131
14 SASI_Mm01_00133427 predicted 1283
15 SASI_Mm01_00133430 predicted 811
16 SASI_Mm01_00133431 predicted 706
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172207
CAMKK1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-599s1c1
Sequence:CCGGGACAGACACTATGCAATGAAACTCGAGTTTCATTGCATAGTGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1434s1c1
Sequence:CCGGACAAGAATCCCGAGACGAGAACTCGAGTTCTCGTCTCGGGATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1285s1c1
Sequence:CCGGCACGTTGTACTGCTTTGTCTACTCGAGTAGACAAAGCAGTACAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1311s1c1
Sequence:CCGGAGTGCCCATTCATCGACGATTCTCGAGAATCGTCGATGAATGGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-578s1c1
Sequence:CCGGCTGGCCTACAACGAAAGTGAACTCGAGTTCACTTTCGTTGTAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-812s1c1
Sequence:CCGGGCTGAGGACAACCTCTATTTGCTCGAGCAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-356s1c1
Sequence:CCGGGCCAGGAAGCTTTCCCTACAGCTCGAGCTGTAGGGAAAGCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-769s1c1
Sequence:CCGGCCACGTGAATGTGGTCAAACTCTCGAGAGTTTGACCACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172207.1-1990s1c1
Sequence:CCGGCCTTCTTCCATGCAGCTTGATCTCGAGATCAAGCTGCATGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-212s1c1
Sequence:CCGGGCCATCGATGTGACTCACTTGCTCGAGCAAGTGAGTCACATCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-1997s21c1
Sequence:CCGGCCATGCAGCTTGATGTCACTCCTCGAGGAGTGACATCAAGCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1547s21c1
Sequence:CCGGGTGACAGAGGAGGAGGTTAAGCTCGAGCTTAACCTCCTCCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1359s21c1
Sequence:CCGGAGAATGAGCCCGTGGTGTTTCCTCGAGGAAACACCACGGGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-837s21c1
Sequence:CCGGTGCAGAACCAGGCCCAGAATACTCGAGTATTCTGGGCCTGGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-2250s21c1
Sequence:CCGGAGTGCTTGTTCAGTGAGTAAGCTCGAGCTTACTCACTGAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-531s21c1
Sequence:CCGGACAAGCTGCAGAGTGAGATTGCTCGAGCAATCTCACTCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1312s21c1
Sequence:CCGGGTGCCCATTCATCGACGATTTCTCGAGAAATCGTCGATGAATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-811s21c1
Sequence:CCGGAGCTGAGGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172207
CAMKK1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-599s1c1
Sequence:CCGGGACAGACACTATGCAATGAAACTCGAGTTTCATTGCATAGTGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1434s1c1
Sequence:CCGGACAAGAATCCCGAGACGAGAACTCGAGTTCTCGTCTCGGGATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1285s1c1
Sequence:CCGGCACGTTGTACTGCTTTGTCTACTCGAGTAGACAAAGCAGTACAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1311s1c1
Sequence:CCGGAGTGCCCATTCATCGACGATTCTCGAGAATCGTCGATGAATGGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-578s1c1
Sequence:CCGGCTGGCCTACAACGAAAGTGAACTCGAGTTCACTTTCGTTGTAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-812s1c1
Sequence:CCGGGCTGAGGACAACCTCTATTTGCTCGAGCAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-356s1c1
Sequence:CCGGGCCAGGAAGCTTTCCCTACAGCTCGAGCTGTAGGGAAAGCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-769s1c1
Sequence:CCGGCCACGTGAATGTGGTCAAACTCTCGAGAGTTTGACCACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172207.1-1990s1c1
Sequence:CCGGCCTTCTTCCATGCAGCTTGATCTCGAGATCAAGCTGCATGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-212s1c1
Sequence:CCGGGCCATCGATGTGACTCACTTGCTCGAGCAAGTGAGTCACATCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-1997s21c1
Sequence:CCGGCCATGCAGCTTGATGTCACTCCTCGAGGAGTGACATCAAGCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1547s21c1
Sequence:CCGGGTGACAGAGGAGGAGGTTAAGCTCGAGCTTAACCTCCTCCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1359s21c1
Sequence:CCGGAGAATGAGCCCGTGGTGTTTCCTCGAGGAAACACCACGGGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-837s21c1
Sequence:CCGGTGCAGAACCAGGCCCAGAATACTCGAGTATTCTGGGCCTGGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-2250s21c1
Sequence:CCGGAGTGCTTGTTCAGTGAGTAAGCTCGAGCTTACTCACTGAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-531s21c1
Sequence:CCGGACAAGCTGCAGAGTGAGATTGCTCGAGCAATCTCACTCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1312s21c1
Sequence:CCGGGTGCCCATTCATCGACGATTTCTCGAGAAATCGTCGATGAATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-811s21c1
Sequence:CCGGAGCTGAGGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172207
CAMKK1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-599s1c1
Sequence:CCGGGACAGACACTATGCAATGAAACTCGAGTTTCATTGCATAGTGTCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1434s1c1
Sequence:CCGGACAAGAATCCCGAGACGAGAACTCGAGTTCTCGTCTCGGGATTCTTGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1285s1c1
Sequence:CCGGCACGTTGTACTGCTTTGTCTACTCGAGTAGACAAAGCAGTACAACGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-1311s1c1
Sequence:CCGGAGTGCCCATTCATCGACGATTCTCGAGAATCGTCGATGAATGGGCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.x-578s1c1
Sequence:CCGGCTGGCCTACAACGAAAGTGAACTCGAGTTCACTTTCGTTGTAGGCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-812s1c1
Sequence:CCGGGCTGAGGACAACCTCTATTTGCTCGAGCAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-356s1c1
Sequence:CCGGGCCAGGAAGCTTTCCCTACAGCTCGAGCTGTAGGGAAAGCTTCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-769s1c1
Sequence:CCGGCCACGTGAATGTGGTCAAACTCTCGAGAGTTTGACCACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199296    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172207.1-1990s1c1
Sequence:CCGGCCTTCTTCCATGCAGCTTGATCTCGAGATCAAGCTGCATGGAAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172207.1-212s1c1
Sequence:CCGGGCCATCGATGTGACTCACTTGCTCGAGCAAGTGAGTCACATCGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367436    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-1997s21c1
Sequence:CCGGCCATGCAGCTTGATGTCACTCCTCGAGGAGTGACATCAAGCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1547s21c1
Sequence:CCGGGTGACAGAGGAGGAGGTTAAGCTCGAGCTTAACCTCCTCCTCTGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1359s21c1
Sequence:CCGGAGAATGAGCCCGTGGTGTTTCCTCGAGGAAACACCACGGGCTCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-837s21c1
Sequence:CCGGTGCAGAACCAGGCCCAGAATACTCGAGTATTCTGGGCCTGGTTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256591    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172207.2-2250s21c1
Sequence:CCGGAGTGCTTGTTCAGTGAGTAAGCTCGAGCTTACTCACTGAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-531s21c1
Sequence:CCGGACAAGCTGCAGAGTGAGATTGCTCGAGCAATCTCACTCTGCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-1312s21c1
Sequence:CCGGGTGCCCATTCATCGACGATTTCTCGAGAAATCGTCGATGAATGGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172207.2-811s21c1
Sequence:CCGGAGCTGAGGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018883
VALIDATED
CAMKK1 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-779s1c1
Sequence:CCGGCGCTGAAGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-935s1c1
Sequence:CCGGCAGGGACATCAAGCCATCTAACTCGAGTTAGATGGCTTGATGTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018883.1-1484s1c1
Sequence:CCGGGCGTTCCTTTGGAAACCCATTCTCGAGAATGGGTTTCCAAAGGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1139s1c1
Sequence:CCGGCACGCTATATTGCTTTGTCTACTCGAGTAGACAAAGCAATATAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1552s1c1
Sequence:CCGGGCTTACTGATGAAAGAAGGATCTCGAGATCCTTCTTTCATCAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-2125s21c1
Sequence:CCGGGCGTGGATGCTACGGATAATGCTCGAGCATTATCCGTAGCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1500s21c1
Sequence:CCGGGTGATCCTGGTCAAGTCTATGCTCGAGCATAGACTTGACCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1035s21c1
Sequence:CCGGGCCGACTTTGGTGTCAGTAACCTCGAGGTTACTGACACCAAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-781s21c1
Sequence:CCGGACCACGTGAATGTAGTCAAATCTCGAGATTTGACTACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1357s21c1
Sequence:CCGGGGGTGTCAGATATCAAGTTACCTCGAGGTAACTTGATATCTGACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018883
VALIDATED
CAMKK1 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-779s1c1
Sequence:CCGGCGCTGAAGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-935s1c1
Sequence:CCGGCAGGGACATCAAGCCATCTAACTCGAGTTAGATGGCTTGATGTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018883.1-1484s1c1
Sequence:CCGGGCGTTCCTTTGGAAACCCATTCTCGAGAATGGGTTTCCAAAGGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1139s1c1
Sequence:CCGGCACGCTATATTGCTTTGTCTACTCGAGTAGACAAAGCAATATAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1552s1c1
Sequence:CCGGGCTTACTGATGAAAGAAGGATCTCGAGATCCTTCTTTCATCAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-2125s21c1
Sequence:CCGGGCGTGGATGCTACGGATAATGCTCGAGCATTATCCGTAGCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1500s21c1
Sequence:CCGGGTGATCCTGGTCAAGTCTATGCTCGAGCATAGACTTGACCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1035s21c1
Sequence:CCGGGCCGACTTTGGTGTCAGTAACCTCGAGGTTACTGACACCAAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-781s21c1
Sequence:CCGGACCACGTGAATGTAGTCAAATCTCGAGATTTGACTACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1357s21c1
Sequence:CCGGGGGTGTCAGATATCAAGTTACCTCGAGGTAACTTGATATCTGACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018883
VALIDATED
CAMKK1 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase kinase 1, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-779s1c1
Sequence:CCGGCGCTGAAGACAACCTCTATTTCTCGAGAAATAGAGGTTGTCTTCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-935s1c1
Sequence:CCGGCAGGGACATCAAGCCATCTAACTCGAGTTAGATGGCTTGATGTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_018883.1-1484s1c1
Sequence:CCGGGCGTTCCTTTGGAAACCCATTCTCGAGAATGGGTTTCCAAAGGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1139s1c1
Sequence:CCGGCACGCTATATTGCTTTGTCTACTCGAGTAGACAAAGCAATATAGCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018883.1-1552s1c1
Sequence:CCGGGCTTACTGATGAAAGAAGGATCTCGAGATCCTTCTTTCATCAGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271156    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-2125s21c1
Sequence:CCGGGCGTGGATGCTACGGATAATGCTCGAGCATTATCCGTAGCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1500s21c1
Sequence:CCGGGTGATCCTGGTCAAGTCTATGCTCGAGCATAGACTTGACCAGGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1035s21c1
Sequence:CCGGGCCGACTTTGGTGTCAGTAACCTCGAGGTTACTGACACCAAAGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-781s21c1
Sequence:CCGGACCACGTGAATGTAGTCAAATCTCGAGATTTGACTACATTCACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_018883.2-1357s21c1
Sequence:CCGGGGGTGTCAGATATCAAGTTACCTCGAGGTAACTTGATATCTGACACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks