EMAIL THIS PAGE TO A FRIEND

CAMKK2

calcium/calmodulin-dependent protein kinase kinase 2, beta

167 Gene Product Result for
Synonyms: CAMKK CAMKKB
Gene ID:
Human(10645) Summary: The product of this gene belongs to the Serine/Threonine protein kinase family, and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. The major isoform of this gene plays a role in the calcium/calmodulin-dependent (CaM) kinase cascade by phosphorylating the downstream kinases CaMK1 and CaMK4. Protein products of this gene also phosphorylate AMP-activated protein kinase (AMPK). This gene has its strongest expression in the brain and influences signalling cascades involved with learning and memory, neuronal differentiation and migration, neurite outgrowth, and synapse formation. Alternative splicing results in multiple transcript variants encoding distinct isoforms. The identified isoforms differ in their ability to undergo autophosphorylation and to phosphorylate downstream kinases. [provided by RefSeq, Jul 2012]
Mouse(207565) calcium/calmodulin-dependent protein kinase kinase 2, beta
Rat(83506) calcium/calmodulin-dependent protein kinase kinase 2, beta
naked mole-rat(101723556) calcium/calmodulin-dependent protein kinase kinase 2, beta
domestic guinea pig(100716041) calcium/calmodulin-dependent protein kinase kinase 2, beta
sheep(101103267) calcium/calmodulin-dependent protein kinase kinase 2, beta
chicken(396405) calcium/calmodulin-dependent protein kinase kinase 2, beta
dog(486263) calcium/calmodulin-dependent protein kinase kinase 2, beta
cow(509084) calcium/calmodulin-dependent protein kinase kinase 2, beta
domestic cat(101097674) calcium/calmodulin-dependent protein kinase kinase 2, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153499 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153499 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153499 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145358 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145358 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145358 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
14-931-M CaMKK2, active 10 µg pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006549 Rosetta Predictions human pricing
NM_153499 Rosetta Predictions human pricing
NM_153500 Rosetta Predictions human pricing
NM_172214 Rosetta Predictions human pricing
NM_172215 Rosetta Predictions human pricing
NM_172216 Rosetta Predictions human pricing
NM_172226 Rosetta Predictions human pricing
NM_031338 Rosetta Predictions rat pricing
NM_145358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108816 predicted 1345
2 SASI_Hs01_00108818 predicted 1812
3 SASI_Hs01_00108819 predicted 1787
4 SASI_Hs01_00108820 predicted 1111
5 SASI_Hs01_00108821 predicted 1357
6 SASI_Hs01_00108822 predicted 1695
7 SASI_Hs01_00108823 predicted 1353
8 SASI_Hs01_00108824 predicted 1910
9 SASI_Hs02_00341812 predicted 1718
10 SASI_Hs02_00341813 predicted 1692
11 SASI_Hs01_00108817 predicted 1330
12 SASI_Hs01_00108825 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153499 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100421 predicted 1345
2 SASI_Hs01_00100423 predicted 1810
3 SASI_Hs01_00100424 predicted 1786
4 SASI_Hs01_00100425 predicted 1111
5 SASI_Hs01_00100426 predicted 1349
6 SASI_Hs01_00100427 predicted 1689
7 SASI_Hs01_00100428 predicted 1351
8 SASI_Hs01_00100429 predicted 1915
9 SASI_Hs02_00367320 predicted 1722
10 SASI_Hs02_00367321 predicted 1693
11 SASI_Hs01_00100422 predicted 1329
12 SASI_Hs01_00100430 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153500 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053448 predicted 1347
2 SASI_Hs01_00053450 predicted 1807
3 SASI_Hs01_00053451 predicted 1789
4 SASI_Hs01_00053452 predicted 1115
5 SASI_Hs01_00053453 predicted 1353
6 SASI_Hs01_00053454 predicted 1692
7 SASI_Hs01_00053455 predicted 1354
8 SASI_Hs01_00053456 predicted 1913
9 SASI_Hs02_00367322 predicted 1718
10 SASI_Hs02_00367323 predicted 1692
11 SASI_Hs01_00053449 predicted 1325
12 SASI_Hs01_00053457 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172214 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079080 predicted 1343
2 SASI_Hs01_00079082 predicted 1806
3 SASI_Hs01_00079083 predicted 1786
4 SASI_Hs01_00079084 predicted 1108
5 SASI_Hs01_00079085 predicted 1350
6 SASI_Hs01_00079086 predicted 1687
7 SASI_Hs01_00079087 predicted 1359
8 SASI_Hs01_00079088 predicted 1914
9 SASI_Hs02_00367920 predicted 1723
10 SASI_Hs02_00367921 predicted 1694
11 SASI_Hs01_00079081 predicted 1324
12 SASI_Hs01_00079089 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026384 predicted 1344
2 SASI_Hs01_00026386 predicted 1813
3 SASI_Hs01_00026387 predicted 1781
4 SASI_Hs01_00026388 predicted 1107
5 SASI_Hs01_00026389 predicted 1349
6 SASI_Hs01_00026390 predicted 1690
7 SASI_Hs01_00026391 predicted 1353
8 SASI_Hs01_00026392 predicted 1908
9 SASI_Hs02_00367922 predicted 1723
10 SASI_Hs02_00367923 predicted 1690
11 SASI_Hs01_00026385 predicted 1324
12 SASI_Hs01_00026393 predicted 1528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172216 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144548 predicted 1341
2 SASI_Hs01_00144550 predicted 1810
3 SASI_Hs01_00144551 predicted 1788
4 SASI_Hs01_00144552 predicted 1108
5 SASI_Hs01_00144553 predicted 1353
6 SASI_Hs01_00144554 predicted 1687
7 SASI_Hs01_00144555 predicted 1359
8 SASI_Hs01_00144556 predicted 1909
9 SASI_Hs02_00367924 predicted 1720
10 SASI_Hs02_00367925 predicted 1691
11 SASI_Hs01_00144549 predicted 1326
12 SASI_Hs01_00144557 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074563 predicted 643
2 SASI_Hs01_00074565 predicted 1105
3 SASI_Hs01_00074566 predicted 1085
4 SASI_Hs01_00074567 predicted 407
5 SASI_Hs01_00074568 predicted 653
6 SASI_Hs01_00074569 predicted 984
7 SASI_Hs01_00074570 predicted 654
8 SASI_Hs01_00074571 predicted 1208
9 SASI_Hs02_00367936 predicted 1013
10 SASI_Hs02_00367937 predicted 988
11 SASI_Hs01_00074564 predicted 625
12 SASI_Hs01_00074572 predicted 829
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112453 predicted 1549
2 SASI_Rn01_00112454 predicted 1564
3 SASI_Rn01_00112455 predicted 681
4 SASI_Rn01_00112456 predicted 1536
5 SASI_Rn02_00264572 predicted 995
6 SASI_Rn01_00112457 predicted 1253
7 SASI_Rn01_00112458 predicted 1018
8 SASI_Rn01_00112459 predicted 694
9 SASI_Rn01_00112460 predicted 891
10 SASI_Rn01_00112461 predicted 1287
11 SASI_Rn01_00112462 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093283 predicted 603
2 SASI_Mm01_00093284 predicted 1486
3 SASI_Mm01_00093285 predicted 1584
4 SASI_Mm01_00093286 predicted 1132
5 SASI_Mm01_00093287 predicted 1460
6 SASI_Mm01_00093288 predicted 817
7 SASI_Mm01_00093289 predicted 1208
8 SASI_Mm01_00093290 predicted 1341
9 SASI_Mm01_00093291 predicted 1225
10 SASI_Mm01_00093292 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153499
VALIDATED
CAMKK2 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase kinase 2, beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-1952s21c1
Sequence:CCGGGCCATGGGTGTGACACTATACCTCGAGGTATAGTGTCACACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-2666s21c1
Sequence:CCGGATCGTCATCTCTGGTTATTTGCTCGAGCAAATAACCAGAGATGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153499.2-1362s21c1
Sequence:CCGGTCGTCAAGTTGGCCTACAATGCTCGAGCATTGTAGGCCAACTTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-946s1c1
Sequence:CCGGCCTCTCATCCTTGAGCATCCACTCGAGTGGATGCTCAAGGATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-5368s1c1
Sequence:CCGGCCCGATGCTTCTGTTTCATTCCTCGAGGAATGAAACAGAAGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-1390s1c1
Sequence:CCGGCAATACCTACTATGCAATGAACTCGAGTTCATTGCATAGTAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-4867s1c1
Sequence:CCGGGCAAAGAGGACGCCCATAATTCTCGAGAATTATGGGCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2005s1c1
Sequence:CCGGCGAGCGGATCATGTGTTTACACTCGAGTGTAAACACATGATCCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2251s1c1
Sequence:CCGGAGTCAAACACATTCCCAGCTTCTCGAGAAGCTGGGAATGTGTTTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-5390s1c1
Sequence:CCGGCGACCCTTTCTACTATGCATTCTCGAGAATGCATAGTAGAAAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-2288s1c1
Sequence:CCGGGTGAAGACCATGATACGTAAACTCGAGTTTACGTATCATGGTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-1696s1c1
Sequence:CCGGCCGTTTCTACTTCCAGGATCTCTCGAGAGATCCTGGAAGTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153499
VALIDATED
CAMKK2 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase kinase 2, beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-1952s21c1
Sequence:CCGGGCCATGGGTGTGACACTATACCTCGAGGTATAGTGTCACACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-2666s21c1
Sequence:CCGGATCGTCATCTCTGGTTATTTGCTCGAGCAAATAACCAGAGATGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153499.2-1362s21c1
Sequence:CCGGTCGTCAAGTTGGCCTACAATGCTCGAGCATTGTAGGCCAACTTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-946s1c1
Sequence:CCGGCCTCTCATCCTTGAGCATCCACTCGAGTGGATGCTCAAGGATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-5368s1c1
Sequence:CCGGCCCGATGCTTCTGTTTCATTCCTCGAGGAATGAAACAGAAGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-1390s1c1
Sequence:CCGGCAATACCTACTATGCAATGAACTCGAGTTCATTGCATAGTAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-4867s1c1
Sequence:CCGGGCAAAGAGGACGCCCATAATTCTCGAGAATTATGGGCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2005s1c1
Sequence:CCGGCGAGCGGATCATGTGTTTACACTCGAGTGTAAACACATGATCCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2251s1c1
Sequence:CCGGAGTCAAACACATTCCCAGCTTCTCGAGAAGCTGGGAATGTGTTTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-5390s1c1
Sequence:CCGGCGACCCTTTCTACTATGCATTCTCGAGAATGCATAGTAGAAAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-2288s1c1
Sequence:CCGGGTGAAGACCATGATACGTAAACTCGAGTTTACGTATCATGGTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-1696s1c1
Sequence:CCGGCCGTTTCTACTTCCAGGATCTCTCGAGAGATCCTGGAAGTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153499
VALIDATED
CAMKK2 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase kinase 2, beta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-1952s21c1
Sequence:CCGGGCCATGGGTGTGACACTATACCTCGAGGTATAGTGTCACACCCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363122    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_153499.2-2666s21c1
Sequence:CCGGATCGTCATCTCTGGTTATTTGCTCGAGCAAATAACCAGAGATGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153499.2-1362s21c1
Sequence:CCGGTCGTCAAGTTGGCCTACAATGCTCGAGCATTGTAGGCCAACTTGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-946s1c1
Sequence:CCGGCCTCTCATCCTTGAGCATCCACTCGAGTGGATGCTCAAGGATGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195473    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-5368s1c1
Sequence:CCGGCCCGATGCTTCTGTTTCATTCCTCGAGGAATGAAACAGAAGCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194684    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153499.2-1390s1c1
Sequence:CCGGCAATACCTACTATGCAATGAACTCGAGTTCATTGCATAGTAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196992    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153499.2-4867s1c1
Sequence:CCGGGCAAAGAGGACGCCCATAATTCTCGAGAATTATGGGCGTCCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2005s1c1
Sequence:CCGGCGAGCGGATCATGTGTTTACACTCGAGTGTAAACACATGATCCGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-2251s1c1
Sequence:CCGGAGTCAAACACATTCCCAGCTTCTCGAGAAGCTGGGAATGTGTTTGACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002301    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-5390s1c1
Sequence:CCGGCGACCCTTTCTACTATGCATTCTCGAGAATGCATAGTAGAAAGGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153499.x-2288s1c1
Sequence:CCGGGTGAAGACCATGATACGTAAACTCGAGTTTACGTATCATGGTCTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153499.x-1696s1c1
Sequence:CCGGCCGTTTCTACTTCCAGGATCTCTCGAGAGATCCTGGAAGTAGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145358
VALIDATED
CAMKK2 MISSION shRNA Bacterial Glycerol Stock
calcium/calmodulin-dependent protein kinase kinase 2, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-178s21c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-2028s21c1
Sequence:CCGGGACTCCATGTCGTCGACTTTGCTCGAGCAAAGTCGACGACATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1516s21c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1275s21c1
Sequence:CCGGTTTCCCGACCAGCCCGATATACTCGAGTATATCGGGCTGGTCGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1043s21c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1043s1c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1214s1c1
Sequence:CCGGCCCTTTCATGGATGAACGAATCTCGAGATTCGTTCATCCATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-178s1c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1516s1c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-533s1c1
Sequence:CCGGGCTGAATCAGTACACCCTGAACTCGAGTTCAGGGTGTACTGATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145358
VALIDATED
CAMKK2 MISSION shRNA shRNA Plasmid DNA
calcium/calmodulin-dependent protein kinase kinase 2, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-178s21c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-2028s21c1
Sequence:CCGGGACTCCATGTCGTCGACTTTGCTCGAGCAAAGTCGACGACATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1516s21c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1275s21c1
Sequence:CCGGTTTCCCGACCAGCCCGATATACTCGAGTATATCGGGCTGGTCGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1043s21c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1043s1c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1214s1c1
Sequence:CCGGCCCTTTCATGGATGAACGAATCTCGAGATTCGTTCATCCATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-178s1c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1516s1c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-533s1c1
Sequence:CCGGGCTGAATCAGTACACCCTGAACTCGAGTTCAGGGTGTACTGATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145358
VALIDATED
CAMKK2 MISSION shRNA Lentiviral Transduction Particles
calcium/calmodulin-dependent protein kinase kinase 2, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-178s21c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281992    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-2028s21c1
Sequence:CCGGGACTCCATGTCGTCGACTTTGCTCGAGCAAAGTCGACGACATGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1516s21c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1275s21c1
Sequence:CCGGTTTCCCGACCAGCCCGATATACTCGAGTATATCGGGCTGGTCGGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145358.1-1043s21c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1043s1c1
Sequence:CCGGCGGTGTAAGCAACGAGTTCAACTCGAGTTGAACTCGTTGCTTACACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1214s1c1
Sequence:CCGGCCCTTTCATGGATGAACGAATCTCGAGATTCGTTCATCCATGAAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-178s1c1
Sequence:CCGGGTATCCACTTGGGCATGGAATCTCGAGATTCCATGCCCAAGTGGATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-1516s1c1
Sequence:CCGGCCATGATTCGAAAGCGCTCATCTCGAGATGAGCGCTTTCGAATCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145358.1-533s1c1
Sequence:CCGGGCTGAATCAGTACACCCTGAACTCGAGTTCAGGGTGTACTGATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks