EMAIL THIS PAGE TO A FRIEND

CAMKMT

calmodulin-lysine N-methyltransferase

132 Gene Product Result for
Synonyms: C2orf34 CLNMT CaM KMT Cam KMT
UniProtKB ID: Q7Z624, Q4ZG15, Q53SS6, Q8N6P5, Q9H5G8
Gene ID:
Human(79823) Summary: This gene encodes a class I protein methyltransferase that acts in the formation of trimethyllysine in calmodulin. The protein contains a AdoMet-binding motif and may play a role in calcium-dependent signaling. [provided by RefSeq, Sep 2012]
Mouse(73582) calmodulin-lysine N-methyltransferase
Rat(299521) calmodulin-lysine N-methyltransferase
naked mole-rat(101725603) calmodulin-lysine N-methyltransferase
domestic guinea pig(100720159) calmodulin-lysine N-methyltransferase
sheep(101116304) calmodulin-lysine N-methyltransferase
chicken(421406) calmodulin-lysine N-methyltransferase
dog(474575) calmodulin-lysine N-methyltransferase
cow(786620) calmodulin-lysine N-methyltransferase
domestic cat(101100045) calmodulin-lysine N-methyltransferase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024766 Rosetta Predictions human pricing
NM_001134463 Rosetta Predictions rat pricing
NM_028576 Rosetta Predictions mouse pricing
XM_355034 Rosetta Predictions mouse pricing
XM_899373 Rosetta Predictions mouse pricing
XM_899380 Rosetta Predictions mouse pricing
XM_899387 Rosetta Predictions mouse pricing
XM_899393 Rosetta Predictions mouse pricing
XM_899398 Rosetta Predictions mouse pricing
XM_899405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084749 predicted 894
2 SASI_Hs01_00084750 predicted 414
3 SASI_Hs01_00084751 predicted 393
4 SASI_Hs01_00084752 predicted 737
5 SASI_Hs01_00084753 predicted 372
6 SASI_Hs01_00084754 predicted 1058
7 SASI_Hs01_00084755 predicted 438
8 SASI_Hs01_00084757 predicted 389
9 SASI_Hs01_00084758 predicted 425
10 SASI_Hs02_00357271 predicted 447
11 SASI_Hs01_00084756 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134463 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256369 predicted 577
2 SASI_Rn02_00256370 predicted 235
3 SASI_Rn02_00256371 predicted 365
4 SASI_Rn02_00256372 predicted 253
5 SASI_Rn02_00256373 predicted 402
6 SASI_Rn02_00256374 predicted 479
7 SASI_Rn02_00256375 predicted 547
8 SASI_Rn02_00256376 predicted 358
9 SASI_Rn02_00256377 predicted 567
10 SASI_Rn02_00256378 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334050 predicted 675
2 SASI_Mm02_00334051 predicted 1016
3 SASI_Mm02_00334052 predicted 332
4 SASI_Mm02_00334053 predicted 551
5 SASI_Mm02_00334054 predicted 1078
6 SASI_Mm02_00334055 predicted 1088
7 SASI_Mm02_00334056 predicted 327
8 SASI_Mm02_00334057 predicted 582
9 SASI_Mm02_00334058 predicted 367
10 SASI_Mm02_00334059 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219498 predicted 786
2 SASI_Mm01_00219499 predicted 1133
3 SASI_Mm01_00219500 predicted 453
4 SASI_Mm01_00219501 predicted 295
5 SASI_Mm01_00219502 predicted 662
6 SASI_Mm01_00219503 predicted 1192
7 SASI_Mm01_00219504 predicted 1205
8 SASI_Mm01_00219505 predicted 287
9 SASI_Mm01_00219506 predicted 706
10 SASI_Mm01_00219507 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269438 predicted 451
2 SASI_Mm01_00269439 predicted 286
3 SASI_Mm01_00269440 predicted 646
4 SASI_Mm01_00269441 predicted 545
5 SASI_Mm01_00269442 predicted 551
6 SASI_Mm01_00269443 predicted 442
7 SASI_Mm01_00269444 predicted 290
8 SASI_Mm01_00269445 predicted 477
9 SASI_Mm01_00269446 predicted 395
10 SASI_Mm01_00269447 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234639 predicted 490
2 SASI_Mm01_00234640 predicted 431
3 SASI_Mm01_00234641 predicted 425
4 SASI_Mm01_00234642 predicted 289
5 SASI_Mm01_00234643 predicted 260
6 SASI_Mm01_00234644 predicted 553
7 SASI_Mm01_00234645 predicted 571
8 SASI_Mm01_00234646 predicted 485
9 SASI_Mm01_00234647 predicted 241
10 SASI_Mm01_00234648 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00252091 predicted 243
2 SASI_Mm01_00252092 predicted 444
3 SASI_Mm01_00252093 predicted 292
4 SASI_Mm01_00252094 predicted 450
5 SASI_Mm01_00252095 predicted 308
6 SASI_Mm01_00252096 predicted 390
7 SASI_Mm01_00252097 predicted 445
8 SASI_Mm01_00252098 predicted 286
9 SASI_Mm01_00252099 predicted 393
10 SASI_Mm01_00252100 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212256 predicted 248
2 SASI_Mm01_00212257 predicted 292
3 SASI_Mm01_00212258 predicted 390
4 SASI_Mm01_00212259 predicted 389
5 SASI_Mm01_00212260 predicted 387
6 SASI_Mm01_00212261 predicted 281
7 SASI_Mm01_00212262 predicted 387
8 SASI_Mm01_00212263 predicted 317
9 SASI_Mm01_00212264 predicted 332
10 SASI_Mm01_00212265 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899398 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277359 predicted 483
2 SASI_Mm01_00277360 predicted 443
3 SASI_Mm01_00277361 predicted 293
4 SASI_Mm01_00277362 predicted 625
5 SASI_Mm01_00277363 predicted 693
6 SASI_Mm01_00277364 predicted 636
7 SASI_Mm01_00277365 predicted 282
8 SASI_Mm01_00277366 predicted 482
9 SASI_Mm01_00277367 predicted 330
10 SASI_Mm01_00277368 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00263492 predicted 450
2 SASI_Mm01_00263493 predicted 295
3 SASI_Mm01_00263494 predicted 547
4 SASI_Mm01_00263495 predicted 441
5 SASI_Mm01_00263496 predicted 281
6 SASI_Mm01_00263497 predicted 479
7 SASI_Mm01_00263498 predicted 396
8 SASI_Mm01_00263499 predicted 492
9 SASI_Mm01_00263500 predicted 630
10 SASI_Mm01_00263501 predicted 284
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024766
VALIDATED
CAMKMT MISSION shRNA Bacterial Glycerol Stock
calmodulin-lysine N-methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-452s1c1
Sequence:CCGGCTACTGCCTCAAGCACAATAACTCGAGTTATTGTGCTTGAGGCAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024766.1-1038s1c1
Sequence:CCGGGAAGAAACGTATCAAGTGCATCTCGAGATGCACTTGATACGTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-696s1c1
Sequence:CCGGGTCTCTCAACTGGAAGGACATCTCGAGATGTCCTTCCAGTTGAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1272s1c1
Sequence:CCGGGCCTGTCTGTGACTTGAATTTCTCGAGAAATTCAAGTCACAGACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-1282s1c1
Sequence:CCGGGACTTGAATTTGACTGGTGAACTCGAGTTCACCAGTCAAATTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-567s1c1
Sequence:CCGGCTGTTAACTGATGGGAATGAACTCGAGTTCATTCCCATCAGTTAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1235s1c1
Sequence:CCGGCCCTAAACCTTTGTTTGTCTTCTCGAGAAGACAAACAAAGGTTTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-333s1c1
Sequence:CCGGCCTGAATACAGTATCTCCTTACTCGAGTAAGGAGATACTGTATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-592s1c1
Sequence:CCGGCCATCAGAAATGTGCAAGACACTCGAGTGTCTTGCACATTTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-675s1c1
Sequence:CCGGCGATGGGATAATGAGACAGATCTCGAGATCTGTCTCATTATCCCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024766
VALIDATED
CAMKMT MISSION shRNA shRNA Plasmid DNA
calmodulin-lysine N-methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-452s1c1
Sequence:CCGGCTACTGCCTCAAGCACAATAACTCGAGTTATTGTGCTTGAGGCAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024766.1-1038s1c1
Sequence:CCGGGAAGAAACGTATCAAGTGCATCTCGAGATGCACTTGATACGTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-696s1c1
Sequence:CCGGGTCTCTCAACTGGAAGGACATCTCGAGATGTCCTTCCAGTTGAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1272s1c1
Sequence:CCGGGCCTGTCTGTGACTTGAATTTCTCGAGAAATTCAAGTCACAGACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-1282s1c1
Sequence:CCGGGACTTGAATTTGACTGGTGAACTCGAGTTCACCAGTCAAATTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-567s1c1
Sequence:CCGGCTGTTAACTGATGGGAATGAACTCGAGTTCATTCCCATCAGTTAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1235s1c1
Sequence:CCGGCCCTAAACCTTTGTTTGTCTTCTCGAGAAGACAAACAAAGGTTTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-333s1c1
Sequence:CCGGCCTGAATACAGTATCTCCTTACTCGAGTAAGGAGATACTGTATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-592s1c1
Sequence:CCGGCCATCAGAAATGTGCAAGACACTCGAGTGTCTTGCACATTTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-675s1c1
Sequence:CCGGCGATGGGATAATGAGACAGATCTCGAGATCTGTCTCATTATCCCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024766
VALIDATED
CAMKMT MISSION shRNA Lentiviral Transduction Particles
calmodulin-lysine N-methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-452s1c1
Sequence:CCGGCTACTGCCTCAAGCACAATAACTCGAGTTATTGTGCTTGAGGCAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_024766.1-1038s1c1
Sequence:CCGGGAAGAAACGTATCAAGTGCATCTCGAGATGCACTTGATACGTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-696s1c1
Sequence:CCGGGTCTCTCAACTGGAAGGACATCTCGAGATGTCCTTCCAGTTGAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129144    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1272s1c1
Sequence:CCGGGCCTGTCTGTGACTTGAATTTCTCGAGAAATTCAAGTCACAGACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-1282s1c1
Sequence:CCGGGACTTGAATTTGACTGGTGAACTCGAGTTCACCAGTCAAATTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-567s1c1
Sequence:CCGGCTGTTAACTGATGGGAATGAACTCGAGTTCATTCCCATCAGTTAACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-1235s1c1
Sequence:CCGGCCCTAAACCTTTGTTTGTCTTCTCGAGAAGACAAACAAAGGTTTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-333s1c1
Sequence:CCGGCCTGAATACAGTATCTCCTTACTCGAGTAAGGAGATACTGTATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_024766.1-592s1c1
Sequence:CCGGCCATCAGAAATGTGCAAGACACTCGAGTGTCTTGCACATTTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024766.1-675s1c1
Sequence:CCGGCGATGGGATAATGAGACAGATCTCGAGATCTGTCTCATTATCCCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028576
CAMKMT MISSION shRNA Bacterial Glycerol Stock
calmodulin-lysine N-methyltransferase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028576.2-1254s21c1
Sequence:CCGGTGACTTGTGGAGCAATCTAAACTCGAGTTTAGATTGCTCCACAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-326s21c1
Sequence:CCGGCATCTCCGTAAGGCATAATAGCTCGAGCTATTATGCCTTACGGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-786s21c1
Sequence:CCGGACAGGGAAAGCGGTGGTATTTCTCGAGAAATACCACCGCTTTCCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-210s21c1
Sequence:CCGGGTGAGAAGATTTGAATCATTTCTCGAGAAATGATTCAAATCTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-750s21c1
Sequence:CCGGAGCCTTGTTGATGCCATAAAGCTCGAGCTTTATGGCATCAACAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028576
CAMKMT MISSION shRNA shRNA Plasmid DNA
calmodulin-lysine N-methyltransferase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028576.2-1254s21c1
Sequence:CCGGTGACTTGTGGAGCAATCTAAACTCGAGTTTAGATTGCTCCACAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-326s21c1
Sequence:CCGGCATCTCCGTAAGGCATAATAGCTCGAGCTATTATGCCTTACGGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-786s21c1
Sequence:CCGGACAGGGAAAGCGGTGGTATTTCTCGAGAAATACCACCGCTTTCCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-210s21c1
Sequence:CCGGGTGAGAAGATTTGAATCATTTCTCGAGAAATGATTCAAATCTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-750s21c1
Sequence:CCGGAGCCTTGTTGATGCCATAAAGCTCGAGCTTTATGGCATCAACAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028576
CAMKMT MISSION shRNA Lentiviral Transduction Particles
calmodulin-lysine N-methyltransferase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028576.2-1254s21c1
Sequence:CCGGTGACTTGTGGAGCAATCTAAACTCGAGTTTAGATTGCTCCACAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-326s21c1
Sequence:CCGGCATCTCCGTAAGGCATAATAGCTCGAGCTATTATGCCTTACGGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-786s21c1
Sequence:CCGGACAGGGAAAGCGGTGGTATTTCTCGAGAAATACCACCGCTTTCCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-210s21c1
Sequence:CCGGGTGAGAAGATTTGAATCATTTCTCGAGAAATGATTCAAATCTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028576.2-750s21c1
Sequence:CCGGAGCCTTGTTGATGCCATAAAGCTCGAGCTTTATGGCATCAACAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)