EMAIL THIS PAGE TO A FRIEND

CAMKV

CaM kinase-like vesicle-associated

172 Gene Product Result for
Synonyms: 1G5 VACAMKL
Gene ID:
Mouse(235604) CaM kinase-like vesicle-associated
Rat(79011) CaM kinase-like vesicle-associated
chicken(770854) CaM kinase-like vesicle-associated
domestic cat(101089588) CaM kinase-like vesicle-associated
cow(525741) CaM kinase-like vesicle-associated
Horse(100052646) CaM kinase-like vesicle-associated
dog(608098) CaM kinase-like vesicle-associated
sheep(101123415) CaM kinase-like vesicle-associated
domestic guinea pig(100713408) CaM kinase-like vesicle-associated
naked mole-rat(101720452) CaM kinase-like vesicle-associated
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145621 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145621 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145621 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024046 Rosetta Predictions human pricing
NM_024000 Rosetta Predictions rat pricing
NM_145621 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205535 predicted 557
2 SASI_Hs01_00205536 predicted 253
3 SASI_Hs01_00205537 predicted 599
4 SASI_Hs01_00205538 predicted 269
5 SASI_Hs01_00205539 predicted 591
6 SASI_Hs02_00356490 predicted 681
7 SASI_Hs01_00205540 predicted 528
8 SASI_Hs01_00205541 predicted 663
9 SASI_Hs01_00205543 predicted 383
10 SASI_Hs01_00205544 predicted 936
11 SASI_Hs01_00205542 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024000 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037769 predicted 779
2 SASI_Rn02_00263837 predicted 406
3 SASI_Rn01_00037771 predicted 678
4 SASI_Rn01_00037772 predicted 469
5 SASI_Rn01_00037773 predicted 835
6 SASI_Rn02_00263838 predicted 1063
7 SASI_Rn01_00037774 predicted 1632
8 SASI_Rn01_00037775 predicted 523
9 SASI_Rn01_00037776 predicted 591
10 SASI_Rn01_00037777 predicted 806
11 SASI_Rn01_00037768 predicted 632
12 SASI_Rn01_00037770 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145621 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031723 predicted 203
2 SASI_Mm01_00031725 predicted 338
3 SASI_Mm01_00031726 predicted 849
4 SASI_Mm01_00031727 predicted 692
5 SASI_Mm02_00341197 predicted 396
6 SASI_Mm01_00031728 predicted 483
7 SASI_Mm01_00031729 predicted 638
8 SASI_Mm01_00031730 predicted 202
9 SASI_Mm01_00031731 predicted 830
10 SASI_Mm01_00031732 predicted 536
11 SASI_Mm01_00031724 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024046
VALIDATED
CAMKV MISSION shRNA Bacterial Glycerol Stock
CaM kinase-like vesicle-associated
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-462s21c1
Sequence:GTACCGGTGACCCGCAAGGAGTACTTTACTCGAGTAAAGTACTCCTTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-939s21c1
Sequence:GTACCGGCTCCATATTGGGATGATATTTCTCGAGAAATATCATCCCAATATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-2792s21c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-1313s21c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-1001s21c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-382s21c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-266s1c1
Sequence:CCGGGATTTGGGACAGGTCATCAAGCTCGAGCTTGATGACCTGTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2360s1c1
Sequence:CCGGCCCTGTTATTTGTGTTATTTCCTCGAGGAAATAACACAAATAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-883s1c1
Sequence:CCGGGAACCATGATAAGAATCTCTTCTCGAGAAGAGATTCTTATCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2792s1c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-1277s1c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-965s1c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-346s1c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-623s1c1
Sequence:CCGGCGGCTGAAGAACTCGAAGATTCTCGAGAATCTTCGAGTTCTTCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-910s1c1
Sequence:CCGGTTGGGATGATATTTCGCAGGCCTCGAGGCCTGCGAAATATCATCCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024046
VALIDATED
CAMKV MISSION shRNA shRNA Plasmid DNA
CaM kinase-like vesicle-associated
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-462s21c1
Sequence:GTACCGGTGACCCGCAAGGAGTACTTTACTCGAGTAAAGTACTCCTTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-939s21c1
Sequence:GTACCGGCTCCATATTGGGATGATATTTCTCGAGAAATATCATCCCAATATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-2792s21c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-1313s21c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-1001s21c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-382s21c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-266s1c1
Sequence:CCGGGATTTGGGACAGGTCATCAAGCTCGAGCTTGATGACCTGTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2360s1c1
Sequence:CCGGCCCTGTTATTTGTGTTATTTCCTCGAGGAAATAACACAAATAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-883s1c1
Sequence:CCGGGAACCATGATAAGAATCTCTTCTCGAGAAGAGATTCTTATCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2792s1c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-1277s1c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-965s1c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-346s1c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-623s1c1
Sequence:CCGGCGGCTGAAGAACTCGAAGATTCTCGAGAATCTTCGAGTTCTTCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-910s1c1
Sequence:CCGGTTGGGATGATATTTCGCAGGCCTCGAGGCCTGCGAAATATCATCCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024046
VALIDATED
CAMKV MISSION shRNA Lentiviral Transduction Particles
CaM kinase-like vesicle-associated
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-462s21c1
Sequence:GTACCGGTGACCCGCAAGGAGTACTTTACTCGAGTAAAGTACTCCTTGCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-939s21c1
Sequence:GTACCGGCTCCATATTGGGATGATATTTCTCGAGAAATATCATCCCAATATGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-2792s21c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024046.3-1313s21c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-1001s21c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_024046.3-382s21c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-266s1c1
Sequence:CCGGGATTTGGGACAGGTCATCAAGCTCGAGCTTGATGACCTGTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2360s1c1
Sequence:CCGGCCCTGTTATTTGTGTTATTTCCTCGAGGAAATAACACAAATAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196494    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024046.3-883s1c1
Sequence:CCGGGAACCATGATAAGAATCTCTTCTCGAGAAGAGATTCTTATCATGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024046.3-2792s1c1
Sequence:CCGGGATGAGGAAGTAGGGTTAAACCTCGAGGTTTAACCCTACTTCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-1277s1c1
Sequence:CCGGGCAAAGAGTGATAATGTGGCCCTCGAGGGCCACATTATCACTCTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-965s1c1
Sequence:CCGGGAGCAAGACCAGCGGATCACTCTCGAGAGTGATCCGCTGGTCTTGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-346s1c1
Sequence:CCGGGCGGAAAGCTGCCAAGAACGACTCGAGTCGTTCTTGGCAGCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-623s1c1
Sequence:CCGGCGGCTGAAGAACTCGAAGATTCTCGAGAATCTTCGAGTTCTTCAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024046.x-910s1c1
Sequence:CCGGTTGGGATGATATTTCGCAGGCCTCGAGGCCTGCGAAATATCATCCCAATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145621
CAMKV MISSION shRNA Bacterial Glycerol Stock
CaM kinase-like vesicle-associated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-755s21c1
Sequence:CCGGCCATTGGCGTCATCATGTATACTCGAGTATACATGATGACGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145621.2-2048s21c1
Sequence:CCGGATCCTTTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-822s21c1
Sequence:CCGGTGACTATGAGAACCACGATAACTCGAGTTATCGTGGTTCTCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-887s21c1
Sequence:CCGGCTCCGTACTGGGACGATATTTCTCGAGAAATATCGTCCCAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-415s1c1
Sequence:CCGGCGCAAGGAATACTTCATCTTTCTCGAGAAAGATGAAGTATTCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1008s1c1
Sequence:CCGGCGCGGCTTCTGATAAGAACATCTCGAGATGTTCTTATCAGAAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-285s1c1
Sequence:CCGGGCTGCACACCTGTAAGAAGTTCTCGAGAACTTCTTACAGGTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-649s1c1
Sequence:CCGGGCTAAGCTAGAGAATGGCCTTCTCGAGAAGGCCATTCTCTAGCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1612s1c1
Sequence:CCGGCCACCCTCTAGTAAAGGAGAACTCGAGTTCTCCTTTACTAGAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145621
CAMKV MISSION shRNA shRNA Plasmid DNA
CaM kinase-like vesicle-associated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-755s21c1
Sequence:CCGGCCATTGGCGTCATCATGTATACTCGAGTATACATGATGACGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145621.2-2048s21c1
Sequence:CCGGATCCTTTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-822s21c1
Sequence:CCGGTGACTATGAGAACCACGATAACTCGAGTTATCGTGGTTCTCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-887s21c1
Sequence:CCGGCTCCGTACTGGGACGATATTTCTCGAGAAATATCGTCCCAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-415s1c1
Sequence:CCGGCGCAAGGAATACTTCATCTTTCTCGAGAAAGATGAAGTATTCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1008s1c1
Sequence:CCGGCGCGGCTTCTGATAAGAACATCTCGAGATGTTCTTATCAGAAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-285s1c1
Sequence:CCGGGCTGCACACCTGTAAGAAGTTCTCGAGAACTTCTTACAGGTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-649s1c1
Sequence:CCGGGCTAAGCTAGAGAATGGCCTTCTCGAGAAGGCCATTCTCTAGCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1612s1c1
Sequence:CCGGCCACCCTCTAGTAAAGGAGAACTCGAGTTCTCCTTTACTAGAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145621
CAMKV MISSION shRNA Lentiviral Transduction Particles
CaM kinase-like vesicle-associated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-755s21c1
Sequence:CCGGCCATTGGCGTCATCATGTATACTCGAGTATACATGATGACGCCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145621.2-2048s21c1
Sequence:CCGGATCCTTTCCCAGGCCCTAAATCTCGAGATTTAGGGCCTGGGAAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-822s21c1
Sequence:CCGGTGACTATGAGAACCACGATAACTCGAGTTATCGTGGTTCTCATAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145621.2-887s21c1
Sequence:CCGGCTCCGTACTGGGACGATATTTCTCGAGAAATATCGTCCCAGTACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-415s1c1
Sequence:CCGGCGCAAGGAATACTTCATCTTTCTCGAGAAAGATGAAGTATTCCTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1008s1c1
Sequence:CCGGCGCGGCTTCTGATAAGAACATCTCGAGATGTTCTTATCAGAAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-285s1c1
Sequence:CCGGGCTGCACACCTGTAAGAAGTTCTCGAGAACTTCTTACAGGTGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-649s1c1
Sequence:CCGGGCTAAGCTAGAGAATGGCCTTCTCGAGAAGGCCATTCTCTAGCTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145621.1-1612s1c1
Sequence:CCGGCCACCCTCTAGTAAAGGAGAACTCGAGTTCTCCTTTACTAGAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks