EMAIL THIS PAGE TO A FRIEND

CAMLG

calcium modulating ligand

75 Gene Product Result for
Synonyms: CAML
UniProtKB ID: P49069, A1L3Y3
Gene ID:
Human(819) Summary: The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin. [provided by RefSeq, Jul 2008]
Rat(81715) calcium modulating ligand
naked mole-rat(101712651) calcium modulating ligand
domestic guinea pig(100730375) calcium modulating ligand
sheep(101119046) calcium modulating ligand
Zebrafish(404622) calcium modulating ligand
chicken(395808) calcium modulating ligand
cow(615658) calcium modulating ligand
domestic cat(101100691) calcium modulating ligand
dog(474684) calcium modulating ligand
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001745 Rosetta Predictions human pricing
NM_053334 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023693 predicted 736
2 SASI_Hs01_00023694 predicted 1257
3 SASI_Hs01_00023696 predicted 433
4 SASI_Hs01_00023697 predicted 591
5 SASI_Hs01_00023698 predicted 772
6 SASI_Hs01_00023699 predicted 647
7 SASI_Hs01_00023700 predicted 362
8 SASI_Hs01_00023701 predicted 1380
9 SASI_Hs01_00023702 predicted 1353
10 SASI_Hs02_00332467 predicted 1261
11 SASI_Hs01_00023695 predicted 474
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053334 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031706 predicted 554
2 SASI_Rn01_00031707 predicted 1017
3 SASI_Rn01_00031708 predicted 1042
4 SASI_Rn01_00031709 predicted 543
5 SASI_Rn01_00031710 predicted 396
6 SASI_Rn01_00031711 predicted 1024
7 SASI_Rn01_00031712 predicted 989
8 SASI_Rn01_00031713 predicted 962
9 SASI_Rn01_00031715 predicted 852
10 SASI_Rn02_00265794 predicted 952
11 SASI_Rn01_00031714 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001745
VALIDATED
CAMLG MISSION shRNA Bacterial Glycerol Stock
calcium modulating ligand
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-866s21c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-841s21c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-340s21c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-272s21c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001745.2-1669s1c1
Sequence:CCGGCCAATAGCATAAATGTCCTTTCTCGAGAAAGGACATTTATGCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001745.2-866s1c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-340s1c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-841s1c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-272s1c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001745
VALIDATED
CAMLG MISSION shRNA shRNA Plasmid DNA
calcium modulating ligand
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-866s21c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-841s21c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-340s21c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-272s21c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001745.2-1669s1c1
Sequence:CCGGCCAATAGCATAAATGTCCTTTCTCGAGAAAGGACATTTATGCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001745.2-866s1c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-340s1c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-841s1c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-272s1c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001745
VALIDATED
CAMLG MISSION shRNA Lentiviral Transduction Particles
calcium modulating ligand
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-866s21c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-841s21c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-340s21c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001745.2-272s21c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001745.2-1669s1c1
Sequence:CCGGCCAATAGCATAAATGTCCTTTCTCGAGAAAGGACATTTATGCTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001745.2-866s1c1
Sequence:CCGGCCGAAGTGATAAATCGATCAACTCGAGTTGATCGATTTATCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-340s1c1
Sequence:CCGGCCTTCCGTTTCAAAGCGAGTACTCGAGTACTCGCTTTGAAACGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-841s1c1
Sequence:CCGGGCACTTCTATTGTCGGGAATTCTCGAGAATTCCCGACAATAGAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001745.2-272s1c1
Sequence:CCGGGCGCGGAAGAAGAAAGTCAAACTCGAGTTTGACTTTCTTCTTCCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks