EMAIL THIS PAGE TO A FRIEND

CAMP

cathelicidin antimicrobial peptide

64 Gene Product Result for
Synonyms: CAP-18 CAP18 CRAMP FALL-39 FALL39 LL37
UniProtKB ID: P49913, Q71SN9
Gene ID:
Human(820) Summary: This gene encodes a member of an antimicrobial peptide family, characterized by a highly conserved N-terminal signal peptide containing a cathelin domain and a structurally variable cationic antimicrobial peptide, which is produced by extracellular proteolysis from the C-terminus. The encoded protein has several functions in addition to antimicrobial activity, including cell chemotaxis, immune mediator induction and inflammatory response regulation. [provided by RefSeq, Aug 2011]
Mouse(12796) cathelicidin antimicrobial peptide
Rat(316010) cathelicidin antimicrobial peptide
chicken(420407) cathelicidin antimicrobial peptide
dog(442947) cathelicidin antimicrobial peptide
domestic cat(100533978) cathelicidin antimicrobial peptide
cow(317650) cathelicidin antimicrobial peptide
domestic guinea pig(100216361) cathelicidin antimicrobial peptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005261 MISSION® esiRNA esiRNA targeting human CAMP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004345 Rosetta Predictions human pricing
NM_001100724 Rosetta Predictions rat pricing
XM_236642 Rosetta Predictions rat pricing
NM_009921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186827 predicted 408
2 SASI_Hs01_00186828 predicted 419
3 SASI_Hs01_00186829 predicted 356
4 SASI_Hs01_00186830 predicted 351
5 SASI_Hs01_00186831 predicted 409
6 SASI_Hs01_00186832 predicted 246
7 SASI_Hs01_00186833 predicted 239
8 SASI_Hs01_00186834 predicted 252
9 SASI_Hs01_00186835 predicted 253
10 SASI_Hs01_00186836 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210398 predicted 207
2 SASI_Rn02_00210399 predicted 266
3 SASI_Rn02_00210400 predicted 213
4 SASI_Rn02_00210401 predicted 336
5 SASI_Rn02_00210402 predicted 249
6 SASI_Rn02_00210403 predicted 213
7 SASI_Rn02_00210404 predicted 285
8 SASI_Rn02_00210405 predicted 203
9 SASI_Rn02_00210406 predicted 204
10 SASI_Rn02_00210407 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00180940 predicted 209
2 SASI_Rn01_00180941 predicted 272
3 SASI_Rn01_00180942 predicted 205
4 SASI_Rn01_00180943 predicted 332
5 SASI_Rn01_00180944 predicted 242
6 SASI_Rn01_00180945 predicted 214
7 SASI_Rn01_00180946 predicted 287
8 SASI_Rn01_00180947 predicted 201
9 SASI_Rn01_00180948 predicted 205
10 SASI_Rn01_00180949 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317452 predicted 340
2 SASI_Mm02_00317453 predicted 238
3 SASI_Mm02_00317454 predicted 336
4 SASI_Mm02_00317455 predicted 211
5 SASI_Mm02_00317456 predicted 270
6 SASI_Mm02_00317457 predicted 218
7 SASI_Mm02_00317458 predicted 271
8 SASI_Mm02_00317459 predicted 230
9 SASI_Mm02_00317460 predicted 243
10 SASI_Mm02_00317461 predicted 234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004345
CAMP MISSION shRNA Bacterial Glycerol Stock
cathelicidin antimicrobial peptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-558s1c1
Sequence:CCGGCGGAAATCTAAAGAGAAGATTCTCGAGAATCTTCTCTTTAGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-506s1c1
Sequence:CCGGCATCAGTTGTGATAAGGATAACTCGAGTTATCCTTATCACAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-257s1c1
Sequence:CCGGGCTTCGTGCTATAGATGGCATCTCGAGATGCCATCTATAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-252s1c1
Sequence:CCGGGCTGTGCTTCGTGCTATAGATCTCGAGATCTATAGCACGAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-509s1c1
Sequence:CCGGCAGTTGTGATAAGGATAACAACTCGAGTTGTTATCCTTATCACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-412s21c1
Sequence:CCGGAGCAGTCACCAGAGGATTGTGCTCGAGCACAATCCTCTGGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-288s21c1
Sequence:CCGGTCCTCGGATGCTAACCTCTACCTCGAGGTAGAGGTTAGCATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-533s21c1
Sequence:CCGGATTTGCCCTGCTGGGTGATTTCTCGAGAAATCACCCAGCAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004345
CAMP MISSION shRNA shRNA Plasmid DNA
cathelicidin antimicrobial peptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-558s1c1
Sequence:CCGGCGGAAATCTAAAGAGAAGATTCTCGAGAATCTTCTCTTTAGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-506s1c1
Sequence:CCGGCATCAGTTGTGATAAGGATAACTCGAGTTATCCTTATCACAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-257s1c1
Sequence:CCGGGCTTCGTGCTATAGATGGCATCTCGAGATGCCATCTATAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-252s1c1
Sequence:CCGGGCTGTGCTTCGTGCTATAGATCTCGAGATCTATAGCACGAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-509s1c1
Sequence:CCGGCAGTTGTGATAAGGATAACAACTCGAGTTGTTATCCTTATCACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-412s21c1
Sequence:CCGGAGCAGTCACCAGAGGATTGTGCTCGAGCACAATCCTCTGGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-288s21c1
Sequence:CCGGTCCTCGGATGCTAACCTCTACCTCGAGGTAGAGGTTAGCATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-533s21c1
Sequence:CCGGATTTGCCCTGCTGGGTGATTTCTCGAGAAATCACCCAGCAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004345
CAMP MISSION shRNA Lentiviral Transduction Particles
cathelicidin antimicrobial peptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-558s1c1
Sequence:CCGGCGGAAATCTAAAGAGAAGATTCTCGAGAATCTTCTCTTTAGATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-506s1c1
Sequence:CCGGCATCAGTTGTGATAAGGATAACTCGAGTTATCCTTATCACAACTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-257s1c1
Sequence:CCGGGCTTCGTGCTATAGATGGCATCTCGAGATGCCATCTATAGCACGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-252s1c1
Sequence:CCGGGCTGTGCTTCGTGCTATAGATCTCGAGATCTATAGCACGAAGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004345.3-509s1c1
Sequence:CCGGCAGTTGTGATAAGGATAACAACTCGAGTTGTTATCCTTATCACAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-412s21c1
Sequence:CCGGAGCAGTCACCAGAGGATTGTGCTCGAGCACAATCCTCTGGTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-288s21c1
Sequence:CCGGTCCTCGGATGCTAACCTCTACCTCGAGGTAGAGGTTAGCATCCGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004345.3-533s21c1
Sequence:CCGGATTTGCCCTGCTGGGTGATTTCTCGAGAAATCACCCAGCAGGGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009921
CAMP MISSION shRNA Bacterial Glycerol Stock
cathelicidin antimicrobial peptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-153s1c1
Sequence:CCGGGTCCCTAGACACCAATCTCTACTCGAGTAGAGATTGGTGTCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-123s1c1
Sequence:CCGGGCTCCGAGCTGTGGATGACTTCTCGAGAAGTCATCCACAGCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-249s1c1
Sequence:CCGGGAAGGAGACTGTATGTGGCAACTCGAGTTGCCACATACAGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-242s1c1
Sequence:CCGGTCCGAGTGAAGGAGACTGTATCTCGAGATACAGTCTCCTTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-397s1c1
Sequence:CCGGCAGCCCTTTCGGTTCAAGAAACTCGAGTTTCTTGAACCGAAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009921
CAMP MISSION shRNA shRNA Plasmid DNA
cathelicidin antimicrobial peptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-153s1c1
Sequence:CCGGGTCCCTAGACACCAATCTCTACTCGAGTAGAGATTGGTGTCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-123s1c1
Sequence:CCGGGCTCCGAGCTGTGGATGACTTCTCGAGAAGTCATCCACAGCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-249s1c1
Sequence:CCGGGAAGGAGACTGTATGTGGCAACTCGAGTTGCCACATACAGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-242s1c1
Sequence:CCGGTCCGAGTGAAGGAGACTGTATCTCGAGATACAGTCTCCTTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-397s1c1
Sequence:CCGGCAGCCCTTTCGGTTCAAGAAACTCGAGTTTCTTGAACCGAAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009921
CAMP MISSION shRNA Lentiviral Transduction Particles
cathelicidin antimicrobial peptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-153s1c1
Sequence:CCGGGTCCCTAGACACCAATCTCTACTCGAGTAGAGATTGGTGTCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-123s1c1
Sequence:CCGGGCTCCGAGCTGTGGATGACTTCTCGAGAAGTCATCCACAGCTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-249s1c1
Sequence:CCGGGAAGGAGACTGTATGTGGCAACTCGAGTTGCCACATACAGTCTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-242s1c1
Sequence:CCGGTCCGAGTGAAGGAGACTGTATCTCGAGATACAGTCTCCTTCACTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009921.1-397s1c1
Sequence:CCGGCAGCCCTTTCGGTTCAAGAAACTCGAGTTTCTTGAACCGAAAGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks