EMAIL THIS PAGE TO A FRIEND

CAMSAP1

calmodulin regulated spectrin-associated protein 1

106 Gene Product Result for
Synonyms: PRO2405 bA100C15.1
Gene ID:
Mouse(227634) calmodulin regulated spectrin-associated protein 1
Rat(296580) calmodulin regulated spectrin-associated protein 1
chicken(417127) calmodulin regulated spectrin-associated protein 1
cow(506553) calmodulin regulated spectrin-associated protein 1
domestic cat(101091663) calmodulin regulated spectrin-associated protein 1
Horse(100068448) calmodulin regulated spectrin-associated protein 1
dog(491257) calmodulin regulated spectrin-associated protein 1
naked mole-rat(101719836) calmodulin regulated spectrin-associated protein 1
domestic guinea pig(100722090) calmodulin regulated spectrin-associated protein 1
sheep(101118095) calmodulin regulated spectrin-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001115076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001115076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001115076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015447 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015447 Rosetta Predictions human pricing
XM_001078134 Rosetta Predictions rat pricing
XM_216007 Rosetta Predictions rat pricing
NM_001115076 Rosetta Predictions mouse pricing
XM_975192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347838 predicted 787
2 SASI_Hs01_00117528 predicted 2139
3 SASI_Hs01_00117529 predicted 3497
4 SASI_Hs01_00117530 predicted 4597
5 SASI_Hs01_00117532 predicted 2175
6 SASI_Hs02_00347839 predicted 665
7 SASI_Hs02_00347840 predicted 569
8 SASI_Hs01_00117535 predicted 4089
9 SASI_Hs01_00117537 predicted 4525
10 SASI_Hs02_00347841 predicted 4293
11 SASI_Hs01_00117531 predicted 2898
12 SASI_Hs01_00117533 predicted 469
13 SASI_Hs01_00117534 predicted 4097
14 SASI_Hs01_00117536 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078134 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00359761 predicted 5026
2 SASI_Rn02_00359762 predicted 3624
3 SASI_Rn02_00359763 predicted 4546
4 SASI_Rn02_00359764 predicted 686
5 SASI_Rn02_00359765 predicted 4770
6 SASI_Rn02_00359766 predicted 525
7 SASI_Rn02_00359767 predicted 899
8 SASI_Rn02_00359768 predicted 2717
9 SASI_Rn02_00359769 predicted 4603
10 SASI_Rn02_00359770 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376376 predicted 5244
2 SASI_Rn02_00376377 predicted 3837
3 SASI_Rn02_00376378 predicted 4764
4 SASI_Rn02_00376379 predicted 904
5 SASI_Rn02_00376380 predicted 4985
6 SASI_Rn02_00376381 predicted 743
7 SASI_Rn02_00376382 predicted 1114
8 SASI_Rn02_00376383 predicted 2935
9 SASI_Rn02_00376384 predicted 4821
10 SASI_Rn02_00376385 predicted 1143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115076 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308917 predicted 3786
2 SASI_Mm02_00308918 predicted 4756
3 SASI_Mm02_00308919 predicted 746
4 SASI_Mm02_00308920 predicted 2881
5 SASI_Mm02_00308921 predicted 1137
6 SASI_Mm02_00308922 predicted 2548
7 SASI_Mm02_00308923 predicted 1091
8 SASI_Mm02_00308924 predicted 4796
9 SASI_Mm02_00308925 predicted 3977
10 SASI_Mm02_00308926 predicted 4229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00225734 predicted 4314
2 SASI_Mm01_00225735 predicted 5283
3 SASI_Mm01_00225736 predicted 4146
4 SASI_Mm01_00225737 predicted 1222
5 SASI_Mm01_00225738 predicted 3405
6 SASI_Mm01_00225739 predicted 1658
7 SASI_Mm01_00225740 predicted 1595
8 SASI_Mm01_00225741 predicted 1626
9 SASI_Mm01_00225742 predicted 5333
10 SASI_Mm01_00225743 predicted 4752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001115076
VALIDATED
CAMSAP1 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1846s21c1
Sequence:CCGGATAGCTTGGCATCTAACATTACTCGAGTAATGTTAGATGCCAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-6062s21c1
Sequence:CCGGGGTGGTTATTTGCGGTTATTTCTCGAGAAATAACCGCAAATAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-4800s21c1
Sequence:CCGGTGTGATGCCAACCACTATATTCTCGAGAATATAGTGGTTGGCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115076.1-3807s21c1
Sequence:CCGGGAGAGTAACCATCGGACATTTCTCGAGAAATGTCCGATGGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1104s21c1
Sequence:CCGGTTAGCAGTGGTTCACTATTATCTCGAGATAATAGTGAACCACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001115076
VALIDATED
CAMSAP1 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1846s21c1
Sequence:CCGGATAGCTTGGCATCTAACATTACTCGAGTAATGTTAGATGCCAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-6062s21c1
Sequence:CCGGGGTGGTTATTTGCGGTTATTTCTCGAGAAATAACCGCAAATAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-4800s21c1
Sequence:CCGGTGTGATGCCAACCACTATATTCTCGAGAATATAGTGGTTGGCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115076.1-3807s21c1
Sequence:CCGGGAGAGTAACCATCGGACATTTCTCGAGAAATGTCCGATGGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1104s21c1
Sequence:CCGGTTAGCAGTGGTTCACTATTATCTCGAGATAATAGTGAACCACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001115076
VALIDATED
CAMSAP1 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1846s21c1
Sequence:CCGGATAGCTTGGCATCTAACATTACTCGAGTAATGTTAGATGCCAAGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-6062s21c1
Sequence:CCGGGGTGGTTATTTGCGGTTATTTCTCGAGAAATAACCGCAAATAACCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-4800s21c1
Sequence:CCGGTGTGATGCCAACCACTATATTCTCGAGAATATAGTGGTTGGCATCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001115076.1-3807s21c1
Sequence:CCGGGAGAGTAACCATCGGACATTTCTCGAGAAATGTCCGATGGTTACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001115076.1-1104s21c1
Sequence:CCGGTTAGCAGTGGTTCACTATTATCTCGAGATAATAGTGAACCACTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015447
VALIDATED
CAMSAP1 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015447.3-6952s21c1
Sequence:CCGGAGTTTCAGACACAGGATTAATCTCGAGATTAATCCTGTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-763s21c1
Sequence:CCGGTTAGCTGTGATTCACTATTATCTCGAGATAATAGTGAATCACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4416s21c1
Sequence:CCGGTAAATCAAACAAGCCGATTATCTCGAGATAATCGGCTTGTTTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4787s21c1
Sequence:CCGGAGAAGGCCCAGACTCGTAAATCTCGAGATTTACGAGTCTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-2128s21c1
Sequence:CCGGGACACCGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-1140s1c1
Sequence:CCGGGAAGAGGAGCTTGTGGCTATTCTCGAGAATAGCCACAAGCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-458s1c1
Sequence:CCGGGCCATTAGTGTTGAAGCCGAACTCGAGTTCGGCTTCAACACTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-3045s1c1
Sequence:CCGGGAAAGCAATCAGCGGACACTTCTCGAGAAGTGTCCGCTGATTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015447
VALIDATED
CAMSAP1 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015447.3-6952s21c1
Sequence:CCGGAGTTTCAGACACAGGATTAATCTCGAGATTAATCCTGTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-763s21c1
Sequence:CCGGTTAGCTGTGATTCACTATTATCTCGAGATAATAGTGAATCACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4416s21c1
Sequence:CCGGTAAATCAAACAAGCCGATTATCTCGAGATAATCGGCTTGTTTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4787s21c1
Sequence:CCGGAGAAGGCCCAGACTCGTAAATCTCGAGATTTACGAGTCTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-2128s21c1
Sequence:CCGGGACACCGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-1140s1c1
Sequence:CCGGGAAGAGGAGCTTGTGGCTATTCTCGAGAATAGCCACAAGCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-458s1c1
Sequence:CCGGGCCATTAGTGTTGAAGCCGAACTCGAGTTCGGCTTCAACACTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-3045s1c1
Sequence:CCGGGAAAGCAATCAGCGGACACTTCTCGAGAAGTGTCCGCTGATTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015447
VALIDATED
CAMSAP1 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015447.3-6952s21c1
Sequence:CCGGAGTTTCAGACACAGGATTAATCTCGAGATTAATCCTGTGTCTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-763s21c1
Sequence:CCGGTTAGCTGTGATTCACTATTATCTCGAGATAATAGTGAATCACAGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4416s21c1
Sequence:CCGGTAAATCAAACAAGCCGATTATCTCGAGATAATCGGCTTGTTTGATTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-4787s21c1
Sequence:CCGGAGAAGGCCCAGACTCGTAAATCTCGAGATTTACGAGTCTGGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_015447.3-2128s21c1
Sequence:CCGGGACACCGAGGGAAGGTTATATCTCGAGATATAACCTTCCCTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-1140s1c1
Sequence:CCGGGAAGAGGAGCTTGTGGCTATTCTCGAGAATAGCCACAAGCTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172608    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-458s1c1
Sequence:CCGGGCCATTAGTGTTGAAGCCGAACTCGAGTTCGGCTTCAACACTAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015447.1-3045s1c1
Sequence:CCGGGAAAGCAATCAGCGGACACTTCTCGAGAAGTGTCCGCTGATTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks