EMAIL THIS PAGE TO A FRIEND

CAMSAP2

calmodulin regulated spectrin-associated protein family, member 2

283 Gene Product Result for
Synonyms: CAMSAP1L1
Gene ID:
Mouse(67886) calmodulin regulated spectrin-associated protein family, member 2
Rat(289400) calmodulin regulated spectrin-associated protein family, member 2
sheep(101107980) calmodulin regulated spectrin-associated protein family, member 2
domestic guinea pig(100735300) calmodulin regulated spectrin-associated protein family, member 2
naked mole-rat(101698569) calmodulin regulated spectrin-associated protein family, member 2
Zebrafish(562741) calmodulin regulated spectrin-associated protein family, member 2
dog(490247) calmodulin regulated spectrin-associated protein family, member 2
cow(520385) calmodulin regulated spectrin-associated protein family, member 2
domestic cat(101095222) calmodulin regulated spectrin-associated protein family, member 2
chicken(424345) calmodulin regulated spectrin-associated protein family, member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203459 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203459 Rosetta Predictions human pricing
NM_001134503 Rosetta Predictions rat pricing
NM_001081360 Rosetta Predictions mouse pricing
XM_129477 Rosetta Predictions mouse pricing
XM_899089 Rosetta Predictions mouse pricing
XM_899101 Rosetta Predictions mouse pricing
XM_899106 Rosetta Predictions mouse pricing
XM_899116 Rosetta Predictions mouse pricing
XM_899121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112204 predicted 468
2 SASI_Hs02_00373387 predicted 1078
3 SASI_Hs01_00112205 predicted 3241
4 SASI_Hs01_00112206 predicted 2150
5 SASI_Hs02_00373388 predicted 2123
6 SASI_Hs01_00112207 predicted 580
7 SASI_Hs02_00373389 predicted 3343
8 SASI_Hs01_00112209 predicted 657
9 SASI_Hs01_00112210 predicted 667
10 SASI_Hs01_00112211 predicted 2655
11 SASI_Hs01_00112208 predicted 775
12 SASI_Hs01_00112212 predicted 2031
13 SASI_Hs01_00112213 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134503 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256519 predicted 1784
2 SASI_Rn02_00256520 predicted 3040
3 SASI_Rn02_00256521 predicted 3617
4 SASI_Rn02_00256522 predicted 1077
5 SASI_Rn02_00256523 predicted 1087
6 SASI_Rn02_00256524 predicted 2275
7 SASI_Rn02_00256525 predicted 2576
8 SASI_Rn02_00256526 predicted 2102
9 SASI_Rn02_00256527 predicted 824
10 SASI_Rn02_00256528 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297651 predicted 3633
2 SASI_Mm02_00297652 predicted 1062
3 SASI_Mm02_00297653 predicted 1793
4 SASI_Mm02_00297654 predicted 4716
5 SASI_Mm02_00297655 predicted 2428
6 SASI_Mm02_00297656 predicted 1078
7 SASI_Mm02_00297657 predicted 2566
8 SASI_Mm02_00297658 predicted 2198
9 SASI_Mm02_00297659 predicted 4000
10 SASI_Mm02_00297660 predicted 2600
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_129477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257847 predicted 3629
2 SASI_Mm01_00257848 predicted 1786
3 SASI_Mm01_00257849 predicted 1213
4 SASI_Mm01_00257850 predicted 2419
5 SASI_Mm01_00257851 predicted 1075
6 SASI_Mm01_00257852 predicted 4698
7 SASI_Mm01_00257853 predicted 4090
8 SASI_Mm01_00257854 predicted 2178
9 SASI_Mm01_00257855 predicted 3985
10 SASI_Mm01_00257856 predicted 2578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257498 predicted 3589
2 SASI_Mm01_00257499 predicted 1073
3 SASI_Mm01_00257500 predicted 1746
4 SASI_Mm01_00257501 predicted 2391
5 SASI_Mm01_00257502 predicted 1084
6 SASI_Mm01_00257503 predicted 4657
7 SASI_Mm01_00257504 predicted 4055
8 SASI_Mm01_00257505 predicted 2153
9 SASI_Mm01_00257506 predicted 3955
10 SASI_Mm01_00257507 predicted 2546
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238602 predicted 3630
2 SASI_Mm01_00238603 predicted 4095
3 SASI_Mm01_00238604 predicted 1075
4 SASI_Mm01_00238605 predicted 1786
5 SASI_Mm01_00238606 predicted 1214
6 SASI_Mm01_00238607 predicted 2417
7 SASI_Mm01_00238608 predicted 1079
8 SASI_Mm01_00238609 predicted 2180
9 SASI_Mm01_00238610 predicted 3992
10 SASI_Mm01_00238611 predicted 2582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00214793 predicted 3588
2 SASI_Mm01_00214794 predicted 1074
3 SASI_Mm01_00214795 predicted 1745
4 SASI_Mm01_00214796 predicted 2386
5 SASI_Mm01_00214797 predicted 1075
6 SASI_Mm01_00214798 predicted 4705
7 SASI_Mm01_00214799 predicted 4060
8 SASI_Mm01_00214800 predicted 2151
9 SASI_Mm01_00214801 predicted 3955
10 SASI_Mm01_00214802 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219528 predicted 3591
2 SASI_Mm01_00219529 predicted 1067
3 SASI_Mm01_00219530 predicted 1755
4 SASI_Mm01_00219531 predicted 2388
5 SASI_Mm01_00219532 predicted 1085
6 SASI_Mm01_00219533 predicted 4693
7 SASI_Mm01_00219534 predicted 4056
8 SASI_Mm01_00219535 predicted 2153
9 SASI_Mm01_00219536 predicted 3959
10 SASI_Mm01_00219537 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00284476 predicted 3648
2 SASI_Mm01_00284477 predicted 1074
3 SASI_Mm01_00284478 predicted 1802
4 SASI_Mm01_00284479 predicted 2439
5 SASI_Mm01_00284480 predicted 1079
6 SASI_Mm01_00284481 predicted 4718
7 SASI_Mm01_00284482 predicted 4112
8 SASI_Mm01_00284483 predicted 2204
9 SASI_Mm01_00284484 predicted 4011
10 SASI_Mm01_00284485 predicted 2600
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203459
VALIDATED
CAMSAP2 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein family, member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-7018s1c1
Sequence:CCGGGCCAAACATTTGTCGTGGTTACTCGAGTAACCACGACAAATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-6332s1c1
Sequence:CCGGCCAGGATATGTAACTCTTATACTCGAGTATAAGAGTTACATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1892s1c1
Sequence:CCGGGCATTGAAGAAGCATTACAAACTCGAGTTTGTAATGCTTCTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1606s1c1
Sequence:CCGGCGAGGAATCACTCGTTCTATTCTCGAGAATAGAACGAGTGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-5208s1c1
Sequence:CCGGGCACCTTTCTTATGATGTTAACTCGAGTTAACATCATAAGAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4955s21c1
Sequence:CCGGAGGTTCACCTGCTTGATATTACTCGAGTAATATCAAGCAGGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1043s21c1
Sequence:CCGGTTGTCAGATTAGAGGATATTTCTCGAGAAATATCCTCTAATCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4113s21c1
Sequence:CCGGATCGCTGAACACGGGTGATAACTCGAGTTATCACCCGTGTTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1176s21c1
Sequence:CCGGCTATGCTGCTTCATCCATAAACTCGAGTTTATGGATGAAGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203459.1-2762s21c1
Sequence:CCGGGCAAGTCACTGGCAGATATAACTCGAGTTATATCTGCCAGTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-2185s21c1
Sequence:CCGGGACATGGATGATGCATCTAAACTCGAGTTTAGATGCATCATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203459
VALIDATED
CAMSAP2 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein family, member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-7018s1c1
Sequence:CCGGGCCAAACATTTGTCGTGGTTACTCGAGTAACCACGACAAATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-6332s1c1
Sequence:CCGGCCAGGATATGTAACTCTTATACTCGAGTATAAGAGTTACATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1892s1c1
Sequence:CCGGGCATTGAAGAAGCATTACAAACTCGAGTTTGTAATGCTTCTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1606s1c1
Sequence:CCGGCGAGGAATCACTCGTTCTATTCTCGAGAATAGAACGAGTGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-5208s1c1
Sequence:CCGGGCACCTTTCTTATGATGTTAACTCGAGTTAACATCATAAGAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4955s21c1
Sequence:CCGGAGGTTCACCTGCTTGATATTACTCGAGTAATATCAAGCAGGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1043s21c1
Sequence:CCGGTTGTCAGATTAGAGGATATTTCTCGAGAAATATCCTCTAATCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4113s21c1
Sequence:CCGGATCGCTGAACACGGGTGATAACTCGAGTTATCACCCGTGTTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1176s21c1
Sequence:CCGGCTATGCTGCTTCATCCATAAACTCGAGTTTATGGATGAAGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203459.1-2762s21c1
Sequence:CCGGGCAAGTCACTGGCAGATATAACTCGAGTTATATCTGCCAGTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-2185s21c1
Sequence:CCGGGACATGGATGATGCATCTAAACTCGAGTTTAGATGCATCATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203459
VALIDATED
CAMSAP2 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein family, member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168344    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-7018s1c1
Sequence:CCGGGCCAAACATTTGTCGTGGTTACTCGAGTAACCACGACAAATGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166929    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-6332s1c1
Sequence:CCGGCCAGGATATGTAACTCTTATACTCGAGTATAAGAGTTACATATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1892s1c1
Sequence:CCGGGCATTGAAGAAGCATTACAAACTCGAGTTTGTAATGCTTCTTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_203459.1-1606s1c1
Sequence:CCGGCGAGGAATCACTCGTTCTATTCTCGAGAATAGAACGAGTGATTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167780    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203459.1-5208s1c1
Sequence:CCGGGCACCTTTCTTATGATGTTAACTCGAGTTAACATCATAAGAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369395    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4955s21c1
Sequence:CCGGAGGTTCACCTGCTTGATATTACTCGAGTAATATCAAGCAGGTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1043s21c1
Sequence:CCGGTTGTCAGATTAGAGGATATTTCTCGAGAAATATCCTCTAATCTGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-4113s21c1
Sequence:CCGGATCGCTGAACACGGGTGATAACTCGAGTTATCACCCGTGTTCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-1176s21c1
Sequence:CCGGCTATGCTGCTTCATCCATAAACTCGAGTTTATGGATGAAGCAGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_203459.1-2762s21c1
Sequence:CCGGGCAAGTCACTGGCAGATATAACTCGAGTTATATCTGCCAGTGACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_203459.1-2185s21c1
Sequence:CCGGGACATGGATGATGCATCTAAACTCGAGTTTAGATGCATCATCCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081360
CAMSAP2 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1078s21c1
Sequence:CCGGGGCTATGATTGATACTCTAATCTCGAGATTAGAGTATCAATCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1491s21c1
Sequence:CCGGTTGTCCGGCTAGAGGATATTTCTCGAGAAATATCCTCTAGCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-4009s21c1
Sequence:CCGGAGTTTCTCTGTCCGATTTAAACTCGAGTTTAAATCGGACAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081360.1-5272s21c1
Sequence:CCGGACGGTTCTTACTAGGTGATAACTCGAGTTATCACCTAGTAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1950s21c1
Sequence:CCGGATGGCGTTTCATTCGACATTTCTCGAGAAATGTCGAATGAAACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081360
CAMSAP2 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1078s21c1
Sequence:CCGGGGCTATGATTGATACTCTAATCTCGAGATTAGAGTATCAATCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1491s21c1
Sequence:CCGGTTGTCCGGCTAGAGGATATTTCTCGAGAAATATCCTCTAGCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-4009s21c1
Sequence:CCGGAGTTTCTCTGTCCGATTTAAACTCGAGTTTAAATCGGACAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081360.1-5272s21c1
Sequence:CCGGACGGTTCTTACTAGGTGATAACTCGAGTTATCACCTAGTAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1950s21c1
Sequence:CCGGATGGCGTTTCATTCGACATTTCTCGAGAAATGTCGAATGAAACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081360
CAMSAP2 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1078s21c1
Sequence:CCGGGGCTATGATTGATACTCTAATCTCGAGATTAGAGTATCAATCATAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1491s21c1
Sequence:CCGGTTGTCCGGCTAGAGGATATTTCTCGAGAAATATCCTCTAGCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-4009s21c1
Sequence:CCGGAGTTTCTCTGTCCGATTTAAACTCGAGTTTAAATCGGACAGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081360.1-5272s21c1
Sequence:CCGGACGGTTCTTACTAGGTGATAACTCGAGTTATCACCTAGTAAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081360.1-1950s21c1
Sequence:CCGGATGGCGTTTCATTCGACATTTCTCGAGAAATGTCGAATGAAACGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks