EMAIL THIS PAGE TO A FRIEND

CAMSAP3

calmodulin regulated spectrin-associated protein family, member 3

70 Gene Product Result for
Synonyms: KIAA1543 NEZHA
UniProtKB ID: Q9P1Y5, Q8NDF1
Gene ID:
Mouse(69697) calmodulin regulated spectrin-associated protein family, member 3
Rat(689074) calmodulin regulated spectrin-associated protein family, member 3
Zebrafish(556256) calmodulin regulated spectrin-associated protein family, member 3
dog(484994) calmodulin regulated spectrin-associated protein family, member 3
cow(616206) calmodulin regulated spectrin-associated protein family, member 3
domestic cat(101080514) calmodulin regulated spectrin-associated protein family, member 3
naked mole-rat(101698720) calmodulin regulated spectrin-associated protein family, member 3
domestic guinea pig(100714473) calmodulin regulated spectrin-associated protein family, member 3
sheep(101123375) calmodulin regulated spectrin-associated protein family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001080429 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080429 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080429 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129661 MISSION® esiRNA esiRNA human KIAA1543 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080429 Rosetta Predictions human pricing
NM_020902 Rosetta Predictions human pricing
XM_048362 Rosetta Predictions human pricing
XM_001069418 Rosetta Predictions rat pricing
NM_027171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080429 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314756 predicted 3639
2 SASI_Hs02_00314757 predicted 1038
3 SASI_Hs02_00314758 predicted 3140
4 SASI_Hs02_00314759 predicted 1889
5 SASI_Hs02_00314760 predicted 1074
6 SASI_Hs02_00314761 predicted 3552
7 SASI_Hs02_00314762 predicted 3863
8 SASI_Hs02_00314763 predicted 3339
9 SASI_Hs02_00314764 predicted 3837
10 SASI_Hs02_00314765 predicted 1090
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354228 predicted 3562
2 SASI_Hs02_00354229 predicted 962
3 SASI_Hs02_00354230 predicted 3063
4 SASI_Hs02_00354231 predicted 1801
5 SASI_Hs02_00354232 predicted 990
6 SASI_Hs02_00354233 predicted 3472
7 SASI_Hs02_00354234 predicted 3783
8 SASI_Hs02_00354235 predicted 3264
9 SASI_Hs02_00354236 predicted 3750
10 SASI_Hs02_00354237 predicted 1005
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_048362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255773 predicted 3554
2 SASI_Hs01_00255774 predicted 450
3 SASI_Hs01_00255775 predicted 951
4 SASI_Hs01_00255776 predicted 3057
5 SASI_Hs01_00255777 predicted 656
6 SASI_Hs01_00255778 predicted 842
7 SASI_Hs01_00255779 predicted 979
8 SASI_Hs01_00255780 predicted 645
9 SASI_Hs01_00255781 predicted 3775
10 SASI_Hs01_00255782 predicted 3252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327917 predicted 2930
2 SASI_Rn02_00327918 predicted 2882
3 SASI_Rn02_00327919 predicted 3224
4 SASI_Rn02_00327920 predicted 2694
5 SASI_Rn02_00327921 predicted 3252
6 SASI_Rn02_00327922 predicted 1109
7 SASI_Rn02_00327923 predicted 2211
8 SASI_Rn02_00327924 predicted 2673
9 SASI_Rn02_00327925 predicted 3184
10 SASI_Rn02_00327926 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181101 predicted 1819
2 SASI_Mm01_00181102 predicted 3612
3 SASI_Mm01_00181103 predicted 3748
4 SASI_Mm02_00331687 predicted 2966
5 SASI_Mm01_00181104 predicted 914
6 SASI_Mm01_00181105 predicted 1098
7 SASI_Mm01_00181106 predicted 3064
8 SASI_Mm01_00181107 predicted 883
9 SASI_Mm01_00181108 predicted 1675
10 SASI_Mm01_00181109 predicted 3083
11 SASI_Mm01_00181110 predicted 2504
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080429
CAMSAP3 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein family, member 3
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3613s21c1
Sequence:CCGGATCGCATTCTGGAGGAAATTGCTCGAGCAATTTCCTCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-2037s21c1
Sequence:CCGGCGACGGATTGAGGCCATATTCCTCGAGGAATATGGCCTCAATCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3149s21c1
Sequence:CCGGGCTGATGGACGACCTCGATAACTCGAGTTATCGAGGTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080429.2-3987s21c1
Sequence:CCGGGGAGGACAGTCAGTCGGTATTCTCGAGAATACCGACTGACTGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080429
CAMSAP3 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein family, member 3
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3613s21c1
Sequence:CCGGATCGCATTCTGGAGGAAATTGCTCGAGCAATTTCCTCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-2037s21c1
Sequence:CCGGCGACGGATTGAGGCCATATTCCTCGAGGAATATGGCCTCAATCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3149s21c1
Sequence:CCGGGCTGATGGACGACCTCGATAACTCGAGTTATCGAGGTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080429.2-3987s21c1
Sequence:CCGGGGAGGACAGTCAGTCGGTATTCTCGAGAATACCGACTGACTGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080429
CAMSAP3 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein family, member 3
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3613s21c1
Sequence:CCGGATCGCATTCTGGAGGAAATTGCTCGAGCAATTTCCTCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-2037s21c1
Sequence:CCGGCGACGGATTGAGGCCATATTCCTCGAGGAATATGGCCTCAATCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080429.2-3149s21c1
Sequence:CCGGGCTGATGGACGACCTCGATAACTCGAGTTATCGAGGTCGTCCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080429.2-3987s21c1
Sequence:CCGGGGAGGACAGTCAGTCGGTATTCTCGAGAATACCGACTGACTGTCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027171
CAMSAP3 MISSION shRNA Bacterial Glycerol Stock
calmodulin regulated spectrin-associated protein family, member 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-1995s1c1
Sequence:CCGGCGACGCATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3740s1c1
Sequence:CCGGCGAAGGCATCTATAAGTACAACTCGAGTTGTACTTATAGATGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-578s1c1
Sequence:CCGGCTTCTCATTTGAGTGGACAAACTCGAGTTTGTCCACTCAAATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-2740s1c1
Sequence:CCGGCCTTAGAGGAAGAGGCATCTTCTCGAGAAGATGCCTCTTCCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3417s1c1
Sequence:CCGGGACTGGGAGAATGGAAGCAATCTCGAGATTGCTTCCATTCTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-2004s1c1
Sequence:CCGGGAGGCAATCTTTGCCAAGCATCTCGAGATGCTTGGCAAAGATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-1059s1c1
Sequence:CCGGGCTGAGATGTATATGTGCTTTCTCGAGAAAGCACATATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027171
CAMSAP3 MISSION shRNA shRNA Plasmid DNA
calmodulin regulated spectrin-associated protein family, member 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-1995s1c1
Sequence:CCGGCGACGCATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3740s1c1
Sequence:CCGGCGAAGGCATCTATAAGTACAACTCGAGTTGTACTTATAGATGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-578s1c1
Sequence:CCGGCTTCTCATTTGAGTGGACAAACTCGAGTTTGTCCACTCAAATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-2740s1c1
Sequence:CCGGCCTTAGAGGAAGAGGCATCTTCTCGAGAAGATGCCTCTTCCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3417s1c1
Sequence:CCGGGACTGGGAGAATGGAAGCAATCTCGAGATTGCTTCCATTCTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-2004s1c1
Sequence:CCGGGAGGCAATCTTTGCCAAGCATCTCGAGATGCTTGGCAAAGATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-1059s1c1
Sequence:CCGGGCTGAGATGTATATGTGCTTTCTCGAGAAAGCACATATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027171
CAMSAP3 MISSION shRNA Lentiviral Transduction Particles
calmodulin regulated spectrin-associated protein family, member 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-1995s1c1
Sequence:CCGGCGACGCATTGAGGCAATCTTTCTCGAGAAAGATTGCCTCAATGCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3740s1c1
Sequence:CCGGCGAAGGCATCTATAAGTACAACTCGAGTTGTACTTATAGATGCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-578s1c1
Sequence:CCGGCTTCTCATTTGAGTGGACAAACTCGAGTTTGTCCACTCAAATGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-2740s1c1
Sequence:CCGGCCTTAGAGGAAGAGGCATCTTCTCGAGAAGATGCCTCTTCCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027171.1-3417s1c1
Sequence:CCGGGACTGGGAGAATGGAAGCAATCTCGAGATTGCTTCCATTCTCCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200287    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-2004s1c1
Sequence:CCGGGAGGCAATCTTTGCCAAGCATCTCGAGATGCTTGGCAAAGATTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197699    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027171.1-1059s1c1
Sequence:CCGGGCTGAGATGTATATGTGCTTTCTCGAGAAAGCACATATACATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks