EMAIL THIS PAGE TO A FRIEND

CAMTA1

calmodulin binding transcription activator 1

272 Gene Product Result for
Synonyms: CANPMR
Gene ID:
Mouse(100072) calmodulin binding transcription activator 1
Rat(362665) calmodulin binding transcription activator 1
chicken(419369) calmodulin binding transcription activator 1
domestic cat(101095352) calmodulin binding transcription activator 1
cow(504811) calmodulin binding transcription activator 1
Horse(100058852) calmodulin binding transcription activator 1
dog(608237) calmodulin binding transcription activator 1
dog(612806) calmodulin binding transcription activator 1
sheep(101115890) calmodulin binding transcription activator 1
domestic guinea pig(100732209) calmodulin binding transcription activator 1
naked mole-rat(101725627) calmodulin binding transcription activator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015215 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015215 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015215 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015215 Rosetta Predictions human pricing
XM_342982 Rosetta Predictions rat pricing
NM_001081557 Rosetta Predictions mouse pricing
XM_355539 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015215 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118767 predicted 467
2 SASI_Hs01_00118768 predicted 3867
3 SASI_Hs01_00118769 predicted 3466
4 SASI_Hs02_00347325 predicted 4182
5 SASI_Hs01_00118770 predicted 3454
6 SASI_Hs01_00118771 predicted 388
7 SASI_Hs01_00118773 predicted 4376
8 SASI_Hs01_00118774 predicted 3436
9 SASI_Hs01_00118775 predicted 1982
10 SASI_Hs02_00347326 predicted 4199
11 SASI_Hs01_00118766 predicted 4164
12 SASI_Hs01_00118772 predicted 3389
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342982 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147956 predicted 529
2 SASI_Rn01_00147957 predicted 612
3 SASI_Rn01_00147958 predicted 642
4 SASI_Rn01_00147959 predicted 602
5 SASI_Rn01_00147960 predicted 665
6 SASI_Rn01_00147961 predicted 863
7 SASI_Rn01_00147962 predicted 534
8 SASI_Rn01_00147963 predicted 924
9 SASI_Rn01_00147964 predicted 518
10 SASI_Rn01_00147965 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298680 predicted 337
2 SASI_Mm02_00298681 predicted 4744
3 SASI_Mm02_00298682 predicted 1258
4 SASI_Mm02_00298683 predicted 2771
5 SASI_Mm02_00298684 predicted 732
6 SASI_Mm02_00298685 predicted 2880
7 SASI_Mm02_00298686 predicted 2761
8 SASI_Mm02_00298687 predicted 4441
9 SASI_Mm02_00298688 predicted 1359
10 SASI_Mm02_00298689 predicted 3242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355539 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246425 predicted 354
2 SASI_Mm01_00246426 predicted 4750
3 SASI_Mm01_00246427 predicted 1262
4 SASI_Mm01_00246428 predicted 2785
5 SASI_Mm01_00246429 predicted 738
6 SASI_Mm01_00246430 predicted 4779
7 SASI_Mm01_00246431 predicted 2896
8 SASI_Mm01_00246432 predicted 2770
9 SASI_Mm01_00246433 predicted 4450
10 SASI_Mm01_00246434 predicted 1374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015215
CAMTA1 MISSION shRNA Bacterial Glycerol Stock
calmodulin binding transcription activator 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-498s1c1
Sequence:CCGGCCCTAAGACAAGACCACAGAACTCGAGTTCTGTGGTCTTGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-4602s1c1
Sequence:CCGGCCCTTCTTCTAATACCAGCTTCTCGAGAAGCTGGTATTAGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-5065s1c1
Sequence:CCGGGCTGTGATTGTACAACAGAAACTCGAGTTTCTGTTGTACAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015215.1-6723s1c1
Sequence:CCGGGCCAAGTAATGTGAATGCTAACTCGAGTTAGCATTCACATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-516s1c1
Sequence:CCGGGAATGGCTCAATGATACTCTACTCGAGTAGAGTATCATTGAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-3942s1c1
Sequence:CCGGGCATAAATTGAACCCTGAGTACTCGAGTACTCAGGGTTCAATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-1033s1c1
Sequence:CCGGCACAAGTGTAACAGCGCCAAACTCGAGTTTGGCGCTGTTACACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-4800s21c1
Sequence:CCGGCCAGACAGCTTTCCGGAAATACTCGAGTATTTCCGGAAAGCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-3879s21c1
Sequence:CCGGTCGTTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015215
CAMTA1 MISSION shRNA shRNA Plasmid DNA
calmodulin binding transcription activator 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-498s1c1
Sequence:CCGGCCCTAAGACAAGACCACAGAACTCGAGTTCTGTGGTCTTGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-4602s1c1
Sequence:CCGGCCCTTCTTCTAATACCAGCTTCTCGAGAAGCTGGTATTAGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-5065s1c1
Sequence:CCGGGCTGTGATTGTACAACAGAAACTCGAGTTTCTGTTGTACAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015215.1-6723s1c1
Sequence:CCGGGCCAAGTAATGTGAATGCTAACTCGAGTTAGCATTCACATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-516s1c1
Sequence:CCGGGAATGGCTCAATGATACTCTACTCGAGTAGAGTATCATTGAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-3942s1c1
Sequence:CCGGGCATAAATTGAACCCTGAGTACTCGAGTACTCAGGGTTCAATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-1033s1c1
Sequence:CCGGCACAAGTGTAACAGCGCCAAACTCGAGTTTGGCGCTGTTACACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-4800s21c1
Sequence:CCGGCCAGACAGCTTTCCGGAAATACTCGAGTATTTCCGGAAAGCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-3879s21c1
Sequence:CCGGTCGTTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015215
CAMTA1 MISSION shRNA Lentiviral Transduction Particles
calmodulin binding transcription activator 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-498s1c1
Sequence:CCGGCCCTAAGACAAGACCACAGAACTCGAGTTCTGTGGTCTTGTCTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-4602s1c1
Sequence:CCGGCCCTTCTTCTAATACCAGCTTCTCGAGAAGCTGGTATTAGAAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-5065s1c1
Sequence:CCGGGCTGTGATTGTACAACAGAAACTCGAGTTTCTGTTGTACAATCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015215.1-6723s1c1
Sequence:CCGGGCCAAGTAATGTGAATGCTAACTCGAGTTAGCATTCACATTACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-516s1c1
Sequence:CCGGGAATGGCTCAATGATACTCTACTCGAGTAGAGTATCATTGAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015215.1-3942s1c1
Sequence:CCGGGCATAAATTGAACCCTGAGTACTCGAGTACTCAGGGTTCAATTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158023    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015215.1-1033s1c1
Sequence:CCGGCACAAGTGTAACAGCGCCAAACTCGAGTTTGGCGCTGTTACACTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-4800s21c1
Sequence:CCGGCCAGACAGCTTTCCGGAAATACTCGAGTATTTCCGGAAAGCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015215.1-3879s21c1
Sequence:CCGGTCGTTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081557
CAMTA1 MISSION shRNA Bacterial Glycerol Stock
calmodulin binding transcription activator 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000231365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-308s21c1
Sequence:CCGGTGAGGAAATTGCGGCTTATTTCTCGAGAAATAAGCCGCAATTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-1530s21c1
Sequence:CCGGCCCGACTGTTTCCTCAATAATCTCGAGATTATTGAGGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081557.1-5866s21c1
Sequence:CCGGGAAACAGCTTACGGGATTTAACTCGAGTTAAATCCCGTAAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-3755s21c1
Sequence:CCGGTCGGTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081557
CAMTA1 MISSION shRNA shRNA Plasmid DNA
calmodulin binding transcription activator 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000231365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-308s21c1
Sequence:CCGGTGAGGAAATTGCGGCTTATTTCTCGAGAAATAAGCCGCAATTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-1530s21c1
Sequence:CCGGCCCGACTGTTTCCTCAATAATCTCGAGATTATTGAGGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081557.1-5866s21c1
Sequence:CCGGGAAACAGCTTACGGGATTTAACTCGAGTTAAATCCCGTAAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-3755s21c1
Sequence:CCGGTCGGTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081557
CAMTA1 MISSION shRNA Lentiviral Transduction Particles
calmodulin binding transcription activator 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000231365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-308s21c1
Sequence:CCGGTGAGGAAATTGCGGCTTATTTCTCGAGAAATAAGCCGCAATTTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-1530s21c1
Sequence:CCGGCCCGACTGTTTCCTCAATAATCTCGAGATTATTGAGGAAACAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081557.1-5866s21c1
Sequence:CCGGGAAACAGCTTACGGGATTTAACTCGAGTTAAATCCCGTAAGCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081557.1-3755s21c1
Sequence:CCGGTCGGTCTGAACCCTCTAATTACTCGAGTAATTAGAGGGTTCAGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks