EMAIL THIS PAGE TO A FRIEND

CAMTA2

calmodulin binding transcription activator 2

55 Gene Product Result for
Gene ID:
Human(23125) Summary: The protein encoded by this gene is a member of the calmodulin-binding transcription activator protein family. Members of this family share a common domain structure that consists of a transcription activation domain, a DNA-binding domain, and a calmodulin-binding domain. The encoded protein may be a transcriptional coactivator of genes involved in cardiac growth. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
Mouse(216874) calmodulin binding transcription activator 2
Rat(287462) calmodulin binding transcription activator 2
Zebrafish(100307072) calmodulin binding transcription activator 2
domestic cat(101091571) calmodulin binding transcription activator 2
Horse(100072844) calmodulin binding transcription activator 2
dog(489454) calmodulin binding transcription activator 2
cow(100859923) calmodulin binding transcription activator 2
naked mole-rat(101721175) calmodulin binding transcription activator 2
sheep(101108500) calmodulin binding transcription activator 2
Domestic Rabbit(100343927) calmodulin binding transcription activator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA051147 Anti-CAMTA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015099 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015099 Rosetta Predictions human pricing
NM_001105801 Rosetta Predictions rat pricing
NM_178116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047520 predicted 3377
2 SASI_Hs01_00047521 predicted 638
3 SASI_Hs01_00047522 predicted 305
4 SASI_Hs01_00047523 predicted 2910
5 SASI_Hs01_00047524 predicted 1929
6 SASI_Hs01_00047525 predicted 1221
7 SASI_Hs01_00047526 predicted 3345
8 SASI_Hs02_00346984 predicted 345
9 SASI_Hs01_00047527 predicted 3430
10 SASI_Hs02_00346985 predicted 485
11 SASI_Hs01_00047528 predicted 3171
12 SASI_Hs01_00047529 predicted 3571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212666 predicted 644
2 SASI_Rn02_00212667 predicted 1625
3 SASI_Rn02_00212668 predicted 3378
4 SASI_Rn02_00212669 predicted 2781
5 SASI_Rn02_00212670 predicted 1228
6 SASI_Rn02_00212671 predicted 497
7 SASI_Rn02_00212672 predicted 3105
8 SASI_Rn02_00212673 predicted 1548
9 SASI_Rn02_00212674 predicted 2666
10 SASI_Rn02_00212675 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152594 predicted 1443
2 SASI_Mm01_00152595 predicted 3401
3 SASI_Mm01_00152596 predicted 2573
4 SASI_Mm01_00152597 predicted 516
5 SASI_Mm02_00348586 predicted 1813
6 SASI_Mm02_00348587 predicted 2983
7 SASI_Mm01_00152598 predicted 3399
8 SASI_Mm01_00152599 predicted 1250
9 SASI_Mm01_00152600 predicted 686
10 SASI_Mm01_00152602 predicted 2921
11 SASI_Mm01_00152601 predicted 1208
12 SASI_Mm01_00152603 predicted 1820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178116
VALIDATED
CAMTA2 MISSION shRNA Bacterial Glycerol Stock
calmodulin binding transcription activator 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-344s21c1
Sequence:CCGGCAATCGTAAGAAGGTGAAATACTCGAGTATTTCACCTTCTTACGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3095s21c1
Sequence:CCGGCCTGGAGAATGTGGATCATTTCTCGAGAAATGATCCACATTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178116.3-4043s21c1
Sequence:CCGGCTTCCTGACTTGCCTTATTTACTCGAGTAAATAAGGCAAGTCAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.3-3406s1c1
Sequence:CCGGCACTTAAGTTTGCACTCTATACTCGAGTATAGAGTGCAAACTTAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-3357s21c1
Sequence:CCGGGCGGTGATCCAACGTTGTTATCTCGAGATAACAACGTTGGATCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-2976s21c1
Sequence:CCGGGCCACACCAGAGCGGATTAAACTCGAGTTTAATCCGCTCTGGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3407s21c1
Sequence:CCGGACTTAAGTTTGCACTCTATAACTCGAGTTATAGAGTGCAAACTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-4155s21c1
Sequence:CCGGCACCTTGACTCCGCATGTTTGCTCGAGCAAACATGCGGAGTCAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-845s1c1
Sequence:CCGGCCACAAATGCAGTAGCACGAACTCGAGTTCGTGCTACTGCATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4070s1c1
Sequence:CCGGCGAGAGTCTCTGATGAATGTACTCGAGTACATTCATCAGAGACTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4325s1c1
Sequence:CCGGCAGAGTATAGTGAAGAATCTACTCGAGTAGATTCTTCACTATACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-1631s1c1
Sequence:CCGGGCCCTTCAGTCTTTCGTCATTCTCGAGAATGACGAAAGACTGAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-1310s1c1
Sequence:CCGGCCAAGGAGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACTCCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-2136s1c1
Sequence:CCGGGCTCCTCCAATTCAGGATGAACTCGAGTTCATCCTGAATTGGAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178116
VALIDATED
CAMTA2 MISSION shRNA shRNA Plasmid DNA
calmodulin binding transcription activator 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-344s21c1
Sequence:CCGGCAATCGTAAGAAGGTGAAATACTCGAGTATTTCACCTTCTTACGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3095s21c1
Sequence:CCGGCCTGGAGAATGTGGATCATTTCTCGAGAAATGATCCACATTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178116.3-4043s21c1
Sequence:CCGGCTTCCTGACTTGCCTTATTTACTCGAGTAAATAAGGCAAGTCAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.3-3406s1c1
Sequence:CCGGCACTTAAGTTTGCACTCTATACTCGAGTATAGAGTGCAAACTTAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-3357s21c1
Sequence:CCGGGCGGTGATCCAACGTTGTTATCTCGAGATAACAACGTTGGATCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-2976s21c1
Sequence:CCGGGCCACACCAGAGCGGATTAAACTCGAGTTTAATCCGCTCTGGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3407s21c1
Sequence:CCGGACTTAAGTTTGCACTCTATAACTCGAGTTATAGAGTGCAAACTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-4155s21c1
Sequence:CCGGCACCTTGACTCCGCATGTTTGCTCGAGCAAACATGCGGAGTCAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-845s1c1
Sequence:CCGGCCACAAATGCAGTAGCACGAACTCGAGTTCGTGCTACTGCATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4070s1c1
Sequence:CCGGCGAGAGTCTCTGATGAATGTACTCGAGTACATTCATCAGAGACTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4325s1c1
Sequence:CCGGCAGAGTATAGTGAAGAATCTACTCGAGTAGATTCTTCACTATACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-1631s1c1
Sequence:CCGGGCCCTTCAGTCTTTCGTCATTCTCGAGAATGACGAAAGACTGAAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-1310s1c1
Sequence:CCGGCCAAGGAGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACTCCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-2136s1c1
Sequence:CCGGGCTCCTCCAATTCAGGATGAACTCGAGTTCATCCTGAATTGGAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178116
VALIDATED
CAMTA2 MISSION shRNA Lentiviral Transduction Particles
calmodulin binding transcription activator 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-344s21c1
Sequence:CCGGCAATCGTAAGAAGGTGAAATACTCGAGTATTTCACCTTCTTACGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3095s21c1
Sequence:CCGGCCTGGAGAATGTGGATCATTTCTCGAGAAATGATCCACATTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178116.3-4043s21c1
Sequence:CCGGCTTCCTGACTTGCCTTATTTACTCGAGTAAATAAGGCAAGTCAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.3-3406s1c1
Sequence:CCGGCACTTAAGTTTGCACTCTATACTCGAGTATAGAGTGCAAACTTAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-3357s21c1
Sequence:CCGGGCGGTGATCCAACGTTGTTATCTCGAGATAACAACGTTGGATCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-2976s21c1
Sequence:CCGGGCCACACCAGAGCGGATTAAACTCGAGTTTAATCCGCTCTGGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178116.3-3407s21c1
Sequence:CCGGACTTAAGTTTGCACTCTATAACTCGAGTTATAGAGTGCAAACTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178116.3-4155s21c1
Sequence:CCGGCACCTTGACTCCGCATGTTTGCTCGAGCAAACATGCGGAGTCAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-845s1c1
Sequence:CCGGCCACAAATGCAGTAGCACGAACTCGAGTTCGTGCTACTGCATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4070s1c1
Sequence:CCGGCGAGAGTCTCTGATGAATGTACTCGAGTACATTCATCAGAGACTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178116.2-4325s1c1
Sequence:CCGGCAGAGTATAGTGAAGAATCTACTCGAGTAGATTCTTCACTATACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-1631s1c1
Sequence:CCGGGCCCTTCAGTCTTTCGTCATTCTCGAGAATGACGAAAGACTGAAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178116.2-1310s1c1
Sequence:CCGGCCAAGGAGTAAACCCAGACTTCTCGAGAAGTCTGGGTTTACTCCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178116.2-2136s1c1
Sequence:CCGGGCTCCTCCAATTCAGGATGAACTCGAGTTCATCCTGAATTGGAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015099
CAMTA2 MISSION shRNA Bacterial Glycerol Stock
calmodulin binding transcription activator 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3369s1c1
Sequence:CCGGGCTGACCTGGATTGCACTTAACTCGAGTTAAGTGCAATCCAGGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-2964s1c1
Sequence:CCGGGCGGATTAAACGAGAGGACTTCTCGAGAAGTCCTCTCGTTTAATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-333s1c1
Sequence:CCGGCCTCTACAATCGCAAGAAGGTCTCGAGACCTTCTTGCGATTGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-696s1c1
Sequence:CCGGCGGGAATGGAACAGAAGAGTTCTCGAGAACTCTTCTGTTCCATTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3615s1c1
Sequence:CCGGCCGGAAGATCATGAGATTCCTCTCGAGAGGAATCTCATGATCTTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-228s1c1
Sequence:CCGGGTGGAATACAAATGAGGAGATCTCGAGATCTCCTCATTTGTATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3449s1c1
Sequence:CCGGGCTACTATGAACAGAAGCGATCTCGAGATCGCTTCTGTTCATAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3372s1c1
Sequence:CCGGGACCTGGATTGCACTTAAGTTCTCGAGAACTTAAGTGCAATCCAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-1930s1c1
Sequence:CCGGGCTTCTGTGCTCTTTGAGTATCTCGAGATACTCAAAGAGCACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015099.2-3810s1c1
Sequence:CCGGGCTTTCCTGTTCACCTTTGTTCTCGAGAACAAAGGTGAACAGGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-327s1c1
Sequence:CCGGCATCATCCTCTACAATCGCAACTCGAGTTGCGATTGTAGAGGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015099
CAMTA2 MISSION shRNA shRNA Plasmid DNA
calmodulin binding transcription activator 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3369s1c1
Sequence:CCGGGCTGACCTGGATTGCACTTAACTCGAGTTAAGTGCAATCCAGGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-2964s1c1
Sequence:CCGGGCGGATTAAACGAGAGGACTTCTCGAGAAGTCCTCTCGTTTAATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-333s1c1
Sequence:CCGGCCTCTACAATCGCAAGAAGGTCTCGAGACCTTCTTGCGATTGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-696s1c1
Sequence:CCGGCGGGAATGGAACAGAAGAGTTCTCGAGAACTCTTCTGTTCCATTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3615s1c1
Sequence:CCGGCCGGAAGATCATGAGATTCCTCTCGAGAGGAATCTCATGATCTTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-228s1c1
Sequence:CCGGGTGGAATACAAATGAGGAGATCTCGAGATCTCCTCATTTGTATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3449s1c1
Sequence:CCGGGCTACTATGAACAGAAGCGATCTCGAGATCGCTTCTGTTCATAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3372s1c1
Sequence:CCGGGACCTGGATTGCACTTAAGTTCTCGAGAACTTAAGTGCAATCCAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-1930s1c1
Sequence:CCGGGCTTCTGTGCTCTTTGAGTATCTCGAGATACTCAAAGAGCACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015099.2-3810s1c1
Sequence:CCGGGCTTTCCTGTTCACCTTTGTTCTCGAGAACAAAGGTGAACAGGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-327s1c1
Sequence:CCGGCATCATCCTCTACAATCGCAACTCGAGTTGCGATTGTAGAGGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015099
CAMTA2 MISSION shRNA Lentiviral Transduction Particles
calmodulin binding transcription activator 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3369s1c1
Sequence:CCGGGCTGACCTGGATTGCACTTAACTCGAGTTAAGTGCAATCCAGGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-2964s1c1
Sequence:CCGGGCGGATTAAACGAGAGGACTTCTCGAGAAGTCCTCTCGTTTAATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-333s1c1
Sequence:CCGGCCTCTACAATCGCAAGAAGGTCTCGAGACCTTCTTGCGATTGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-696s1c1
Sequence:CCGGCGGGAATGGAACAGAAGAGTTCTCGAGAACTCTTCTGTTCCATTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3615s1c1
Sequence:CCGGCCGGAAGATCATGAGATTCCTCTCGAGAGGAATCTCATGATCTTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-228s1c1
Sequence:CCGGGTGGAATACAAATGAGGAGATCTCGAGATCTCCTCATTTGTATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015099.2-3449s1c1
Sequence:CCGGGCTACTATGAACAGAAGCGATCTCGAGATCGCTTCTGTTCATAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-3372s1c1
Sequence:CCGGGACCTGGATTGCACTTAAGTTCTCGAGAACTTAAGTGCAATCCAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-1930s1c1
Sequence:CCGGGCTTCTGTGCTCTTTGAGTATCTCGAGATACTCAAAGAGCACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015099.2-3810s1c1
Sequence:CCGGGCTTTCCTGTTCACCTTTGTTCTCGAGAACAAAGGTGAACAGGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015099.2-327s1c1
Sequence:CCGGCATCATCCTCTACAATCGCAACTCGAGTTGCGATTGTAGAGGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)