EMAIL THIS PAGE TO A FRIEND

CAND1

cullin-associated and neddylation-dissociated 1

162 Gene Product Result for
Synonyms: TIP120 TIP120A
Gene ID:
Mouse(71902) cullin associated and neddylation disassociated 1
Rat(117152) cullin-associated and neddylation-dissociated 1
Zebrafish(406806) cullin-associated and neddylation-dissociated 1
Thale Cress(814786) cullin-associated NEDD8-dissociated protein 1
domestic cat(101094193) cullin-associated and neddylation-dissociated 1
cow(538086) cullin-associated and neddylation-dissociated 1
Horse(100058333) cullin-associated and neddylation-dissociated 1
dog(474437) cullin-associated and neddylation-dissociated 1
fruit fly(34403) Cullin-associated and neddylation-dissociated 1
chicken(417837) cullin-associated and neddylation-dissociated 1
naked mole-rat(101702373) cullin-associated and neddylation-dissociated 1
domestic guinea pig(100734932) cullin-associated and neddylation-dissociated 1
sheep(101107775) cullin-associated and neddylation-dissociated 1
Domestic Rabbit(100347974) cullin-associated and neddylation-dissociated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100337 Anti-CAND1 antibody produced in rabbit affinity isolated antibody mouse, bovine, guinea pig, rabbit, rat, horse, zebrafish, canine, human
western blot pricing
HPA062833 Anti-CAND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA055748 Anti-CAND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA069053 Anti-CAND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
AV34585 Anti-TIP120A antibody produced in rabbit IgG fraction of antiserum canine, guinea pig, zebrafish, mouse, rat, rabbit, bovine, human, horse
western blot pricing
WH0055832M1 Monoclonal Anti-CAND1 antibody produced in mouse clone 5D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1409510 Monoclonal Anti-CAND1 antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, western blot pricing
SAB1409511 Monoclonal Anti-CAND1 antibody produced in mouse clone 5F2, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB1409512 Monoclonal Anti-CAND1 antibody produced in mouse clone 1G5, purified immunoglobulin, buffered aqueous solution human, rat, mouse
ELISA, western blot pricing
SAB1405164 Monoclonal Anti-CAND1, (N-terminal) antibody produced in mouse clone 4D10, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018448 Rosetta Predictions human pricing
NM_054004 Rosetta Predictions rat pricing
NM_027994 Rosetta Predictions mouse pricing
XM_125901 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351985 predicted 2425
2 SASI_Hs01_00235839 predicted 678
3 SASI_Hs02_00351986 predicted 847
4 SASI_Hs02_00351987 predicted 3768
5 SASI_Hs01_00235840 predicted 2104
6 SASI_Hs02_00351988 predicted 2792
7 SASI_Hs01_00235843 predicted 1726
8 SASI_Hs01_00235844 predicted 2554
9 SASI_Hs01_00235845 predicted 3706
10 SASI_Hs01_00235846 predicted 1120
11 SASI_Hs01_00235837 predicted 3347
12 SASI_Hs01_00235838 predicted 2411
13 SASI_Hs01_00235841 predicted 2252
14 SASI_Hs01_00235842 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267008 predicted 3994
2 SASI_Rn01_00094331 predicted 2027
3 SASI_Rn01_00094333 predicted 1053
4 SASI_Rn01_00094334 predicted 2250
5 SASI_Rn01_00094336 predicted 1863
6 SASI_Rn01_00094337 predicted 2825
7 SASI_Rn01_00094338 predicted 1161
8 SASI_Rn01_00094339 predicted 819
9 SASI_Rn02_00267009 predicted 1816
10 SASI_Rn02_00267010 predicted 2839
11 SASI_Rn01_00094330 predicted 722
12 SASI_Rn01_00094332 predicted 3189
13 SASI_Rn01_00094335 predicted 2683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333065 predicted 717
2 SASI_Mm02_00333066 predicted 454
3 SASI_Mm02_00333067 predicted 3113
4 SASI_Mm02_00333068 predicted 3189
5 SASI_Mm02_00333069 predicted 2715
6 SASI_Mm02_00333070 predicted 1048
7 SASI_Mm02_00333071 predicted 2811
8 SASI_Mm02_00333072 predicted 1346
9 SASI_Mm02_00333073 predicted 2674
10 SASI_Mm02_00333074 predicted 1154
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125901 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273042 predicted 895
2 SASI_Mm01_00273043 predicted 3562
3 SASI_Mm01_00273044 predicted 3635
4 SASI_Mm01_00273045 predicted 3153
5 SASI_Mm01_00273046 predicted 1498
6 SASI_Mm01_00273047 predicted 260
7 SASI_Mm01_00273048 predicted 3256
8 SASI_Mm01_00273049 predicted 1789
9 SASI_Mm01_00273050 predicted 1593
10 SASI_Mm01_00273051 predicted 4065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018448
VALIDATED
CAND1 MISSION shRNA Bacterial Glycerol Stock
cullin-associated and neddylation-dissociated 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-2170s1c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018448.x-2355s1c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-3570s1c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-1033s1c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-4233s1c1
Sequence:CCGGTCCATAATCCAGAGGTTGTAACTCGAGTTACAACCTCTGGATTATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-3658s21c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-1121s21c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2258s21c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2443s21c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018448
VALIDATED
CAND1 MISSION shRNA shRNA Plasmid DNA
cullin-associated and neddylation-dissociated 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-2170s1c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018448.x-2355s1c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-3570s1c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-1033s1c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-4233s1c1
Sequence:CCGGTCCATAATCCAGAGGTTGTAACTCGAGTTACAACCTCTGGATTATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-3658s21c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-1121s21c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2258s21c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2443s21c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018448
VALIDATED
CAND1 MISSION shRNA Lentiviral Transduction Particles
cullin-associated and neddylation-dissociated 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-2170s1c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_018448.x-2355s1c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-3570s1c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018448.x-1033s1c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003460    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_018448.x-4233s1c1
Sequence:CCGGTCCATAATCCAGAGGTTGTAACTCGAGTTACAACCTCTGGATTATGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352772    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-3658s21c1
Sequence:CCGGCGGTTGATGATGGTCTGGATACTCGAGTATCCAGACCATCATCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-1121s21c1
Sequence:CCGGGTCAACAACAAGAACCTACATCTCGAGATGTAGGTTCTTGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2258s21c1
Sequence:CCGGCTTGCCTAATACACTTCAGATCTCGAGATCTGAAGTGTATTAGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018448.3-2443s21c1
Sequence:CCGGGTACTCTTTCTGCCCTTGATACTCGAGTATCAAGGGCAGAAAGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027994
VALIDATED
CAND1 MISSION shRNA Bacterial Glycerol Stock
cullin-associated and neddylation-dissociated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2057s21c1
Sequence:GTACCGGCTGCACAATTAAGCGCTTAAACTCGAGTTTAAGCGCTTAATTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-953s21c1
Sequence:CCGGAGTTATGAGCTGCGGAAATATCTCGAGATATTTCCGCAGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-3248s21c1
Sequence:CCGGCCCACGGCTTAAAGGGTATTTCTCGAGAAATACCCTTTAAGCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2099s21c1
Sequence:CCGGAGTCAAGGAAAGGGCTATTTCCTCGAGGAAATAGCCCTTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027994.1-4819s21c1
Sequence:CCGGTTCGCAACTTCTTACTATTATCTCGAGATAATAGTAAGAAGTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027994
VALIDATED
CAND1 MISSION shRNA shRNA Plasmid DNA
cullin-associated and neddylation-dissociated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2057s21c1
Sequence:GTACCGGCTGCACAATTAAGCGCTTAAACTCGAGTTTAAGCGCTTAATTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-953s21c1
Sequence:CCGGAGTTATGAGCTGCGGAAATATCTCGAGATATTTCCGCAGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-3248s21c1
Sequence:CCGGCCCACGGCTTAAAGGGTATTTCTCGAGAAATACCCTTTAAGCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2099s21c1
Sequence:CCGGAGTCAAGGAAAGGGCTATTTCCTCGAGGAAATAGCCCTTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027994.1-4819s21c1
Sequence:CCGGTTCGCAACTTCTTACTATTATCTCGAGATAATAGTAAGAAGTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027994
VALIDATED
CAND1 MISSION shRNA Lentiviral Transduction Particles
cullin-associated and neddylation-dissociated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2057s21c1
Sequence:GTACCGGCTGCACAATTAAGCGCTTAAACTCGAGTTTAAGCGCTTAATTGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-953s21c1
Sequence:CCGGAGTTATGAGCTGCGGAAATATCTCGAGATATTTCCGCAGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-3248s21c1
Sequence:CCGGCCCACGGCTTAAAGGGTATTTCTCGAGAAATACCCTTTAAGCCGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027994.1-2099s21c1
Sequence:CCGGAGTCAAGGAAAGGGCTATTTCCTCGAGGAAATAGCCCTTTCCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239082    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027994.1-4819s21c1
Sequence:CCGGTTCGCAACTTCTTACTATTATCTCGAGATAATAGTAAGAAGTTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks