EMAIL THIS PAGE TO A FRIEND

CAND2

cullin-associated and neddylation-dissociated 2 (putative)

68 Gene Product Result for
Synonyms: TIP120B Tp120b
UniProtKB ID: O75155, B9EGM9, E9KL24
Gene ID:
Mouse(67088) cullin-associated and neddylation-dissociated 2 (putative)
Rat(192226) cullin-associated and neddylation-dissociated 2 (putative)
Zebrafish(555955) cullin-associated and neddylation-dissociated 2 (putative)
cow(533826) cullin-associated and neddylation-dissociated 2 (putative)
Horse(100050966) cullin-associated and neddylation-dissociated 2 (putative)
domestic cat(101096554) cullin-associated and neddylation-dissociated 2 (putative)
dog(484646) cullin-associated and neddylation-dissociated 2 (putative)
chicken(416121) cullin-associated and neddylation-dissociated 2 (putative)
sheep(101107312) cullin-associated and neddylation-dissociated 2 (putative)
Domestic Rabbit(100346969) cullin-associated and neddylation-dissociated 2 (putative)
domestic guinea pig(100720670) cullin-associated and neddylation-dissociated 2 (putative)
naked mole-rat(101723240) cullin-associated and neddylation-dissociated 2 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2900326 Anti-CAND2 antibody produced in rabbit whole antiserum human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB2100338 Anti-CAND2 antibody produced in rabbit affinity isolated antibody zebrafish, mouse, rat, human, rabbit, guinea pig, horse, bovine, canine
western blot pricing
HPA005777 Anti-CAND2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012298 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012298 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012298 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_371617 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371617 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371617 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025958 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025958 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025958 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012298 Rosetta Predictions human pricing
XM_371617 Rosetta Predictions human pricing
XM_932503 Rosetta Predictions human pricing
NM_181362 Rosetta Predictions rat pricing
NM_025958 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344063 predicted 3147
2 SASI_Hs02_00344064 predicted 3219
3 SASI_Hs02_00344065 predicted 2801
4 SASI_Hs02_00344066 predicted 1453
5 SASI_Hs02_00344067 predicted 1738
6 SASI_Hs02_00344068 predicted 1748
7 SASI_Hs02_00344069 predicted 1188
8 SASI_Hs02_00344070 predicted 703
9 SASI_Hs02_00344071 predicted 1688
10 SASI_Hs02_00344072 predicted 2972
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371617 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00266762 predicted 3072
2 SASI_Hs01_00266763 predicted 3151
3 SASI_Hs01_00266764 predicted 1390
4 SASI_Hs01_00266765 predicted 2502
5 SASI_Hs01_00266766 predicted 1660
6 SASI_Hs01_00266767 predicted 3105
7 SASI_Hs01_00266768 predicted 2948
8 SASI_Hs01_00266769 predicted 1673
9 SASI_Hs01_00266770 predicted 1106
10 SASI_Hs01_00266771 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299886 predicted 283
2 SASI_Hs01_00299887 predicted 283
3 SASI_Hs01_00299888 predicted 251
4 SASI_Hs01_00299889 predicted 282
5 SASI_Hs01_00299890 predicted 359
6 SASI_Hs01_00299891 predicted 488
7 SASI_Hs01_00299892 predicted 523
8 SASI_Hs01_00299893 predicted 468
9 SASI_Hs01_00299894 predicted 399
10 SASI_Hs01_00299895 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269677 predicted 1974
2 SASI_Rn01_00071977 predicted 295
3 SASI_Rn02_00269678 predicted 1668
4 SASI_Rn01_00071978 predicted 1893
5 SASI_Rn01_00071979 predicted 3531
6 SASI_Rn01_00071980 predicted 3395
7 SASI_Rn01_00071981 predicted 1190
8 SASI_Rn01_00071982 predicted 1319
9 SASI_Rn01_00071983 predicted 2996
10 SASI_Rn02_00269679 predicted 2023
11 SASI_Rn01_00071984 predicted 2937
12 SASI_Rn01_00071985 predicted 2019
13 SASI_Rn01_00071986 predicted 3403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025958 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087762 predicted 1395
2 SASI_Mm02_00329358 predicted 273
3 SASI_Mm01_00087763 predicted 969
4 SASI_Mm01_00087764 predicted 412
5 SASI_Mm01_00087765 predicted 1646
6 SASI_Mm01_00087766 predicted 423
7 SASI_Mm01_00087767 predicted 612
8 SASI_Mm01_00087768 predicted 1451
9 SASI_Mm02_00329359 predicted 2807
10 SASI_Mm01_00087769 predicted 2975
11 SASI_Mm01_00087770 predicted 3720
12 SASI_Mm01_00087771 predicted 3004
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012298
VALIDATED
CAND2 MISSION shRNA Bacterial Glycerol Stock
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-2744s21c1
Sequence:CCGGACAGCGGTCAAGTTCCTTATCCTCGAGGATAAGGAACTTGACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-473s21c1
Sequence:CCGGCGCACCCTGATCCAATGTTTGCTCGAGCAAACATTGGATCAGGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-3142s21c1
Sequence:CCGGCCGACTCATTGAGCCACTAAGCTCGAGCTTAGTGGCTCAATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-1362s21c1
Sequence:CCGGCTGACTCTTTCTACAAGATTGCTCGAGCAATCTTGTAGAAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-4046s21c1
Sequence:CCGGTTAGCAAATTGGGCAACAATGCTCGAGCATTGTTGCCCAATTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012298
VALIDATED
CAND2 MISSION shRNA shRNA Plasmid DNA
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-2744s21c1
Sequence:CCGGACAGCGGTCAAGTTCCTTATCCTCGAGGATAAGGAACTTGACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-473s21c1
Sequence:CCGGCGCACCCTGATCCAATGTTTGCTCGAGCAAACATTGGATCAGGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-3142s21c1
Sequence:CCGGCCGACTCATTGAGCCACTAAGCTCGAGCTTAGTGGCTCAATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-1362s21c1
Sequence:CCGGCTGACTCTTTCTACAAGATTGCTCGAGCAATCTTGTAGAAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-4046s21c1
Sequence:CCGGTTAGCAAATTGGGCAACAATGCTCGAGCATTGTTGCCCAATTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012298
VALIDATED
CAND2 MISSION shRNA Lentiviral Transduction Particles
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-2744s21c1
Sequence:CCGGACAGCGGTCAAGTTCCTTATCCTCGAGGATAAGGAACTTGACCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-473s21c1
Sequence:CCGGCGCACCCTGATCCAATGTTTGCTCGAGCAAACATTGGATCAGGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-3142s21c1
Sequence:CCGGCCGACTCATTGAGCCACTAAGCTCGAGCTTAGTGGCTCAATGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-1362s21c1
Sequence:CCGGCTGACTCTTTCTACAAGATTGCTCGAGCAATCTTGTAGAAAGAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236707    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_012298.1-4046s21c1
Sequence:CCGGTTAGCAAATTGGGCAACAATGCTCGAGCATTGTTGCCCAATTTGCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371617
VALIDATED
CAND2 MISSION shRNA Bacterial Glycerol Stock
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-1312s1c1
Sequence:CCGGGCTGACTCTTTCTACAAGATTCTCGAGAATCTTGTAGAAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-2986s1c1
Sequence:CCGGGCGGCCTTTGAATGCATGTATCTCGAGATACATGCATTCAAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-1152s1c1
Sequence:CCGGGCTGGTATCAGGCATCATCTTCTCGAGAAGATGATGCCTGATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-423s1c1
Sequence:CCGGCCGCACCCTGATCCAATGTTTCTCGAGAAACATTGGATCAGGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-2694s1c1
Sequence:CCGGCACAGCGGTCAAGTTCCTTATCTCGAGATAAGGAACTTGACCGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371617
VALIDATED
CAND2 MISSION shRNA shRNA Plasmid DNA
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-1312s1c1
Sequence:CCGGGCTGACTCTTTCTACAAGATTCTCGAGAATCTTGTAGAAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-2986s1c1
Sequence:CCGGGCGGCCTTTGAATGCATGTATCTCGAGATACATGCATTCAAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-1152s1c1
Sequence:CCGGGCTGGTATCAGGCATCATCTTCTCGAGAAGATGATGCCTGATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-423s1c1
Sequence:CCGGCCGCACCCTGATCCAATGTTTCTCGAGAAACATTGGATCAGGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-2694s1c1
Sequence:CCGGCACAGCGGTCAAGTTCCTTATCTCGAGATAAGGAACTTGACCGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371617
VALIDATED
CAND2 MISSION shRNA Lentiviral Transduction Particles
cullin-associated and neddylation-dissociated 2 (putative)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-1312s1c1
Sequence:CCGGGCTGACTCTTTCTACAAGATTCTCGAGAATCTTGTAGAAAGAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371617.2-2986s1c1
Sequence:CCGGGCGGCCTTTGAATGCATGTATCTCGAGATACATGCATTCAAAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-1152s1c1
Sequence:CCGGGCTGGTATCAGGCATCATCTTCTCGAGAAGATGATGCCTGATACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-423s1c1
Sequence:CCGGCCGCACCCTGATCCAATGTTTCTCGAGAAACATTGGATCAGGGTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:XM_371617.2-2694s1c1
Sequence:CCGGCACAGCGGTCAAGTTCCTTATCTCGAGATAAGGAACTTGACCGCTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025958
CAND2 MISSION shRNA Bacterial Glycerol Stock
cullin-associated and neddylation-dissociated 2 (putative)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000108580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025958.1-4353s1c1
Sequence:CCGGGCCAGTTATCTGAGTTAATAACTCGAGTTATTAACTCAGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1360s1c1
Sequence:CCGGCGACAACTTAAAGACCGGAATCTCGAGATTCCGGTCTTTAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-2380s1c1
Sequence:CCGGGCACCTGTTTACAACCAGGTTCTCGAGAACCTGGTTGTAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1857s1c1
Sequence:CCGGCGACCTAGAACCCACACTTATCTCGAGATAAGTGTGGGTTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025958
CAND2 MISSION shRNA shRNA Plasmid DNA
cullin-associated and neddylation-dissociated 2 (putative)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000108580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025958.1-4353s1c1
Sequence:CCGGGCCAGTTATCTGAGTTAATAACTCGAGTTATTAACTCAGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1360s1c1
Sequence:CCGGCGACAACTTAAAGACCGGAATCTCGAGATTCCGGTCTTTAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-2380s1c1
Sequence:CCGGGCACCTGTTTACAACCAGGTTCTCGAGAACCTGGTTGTAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1857s1c1
Sequence:CCGGCGACCTAGAACCCACACTTATCTCGAGATAAGTGTGGGTTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025958
CAND2 MISSION shRNA Lentiviral Transduction Particles
cullin-associated and neddylation-dissociated 2 (putative)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000108580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025958.1-4353s1c1
Sequence:CCGGGCCAGTTATCTGAGTTAATAACTCGAGTTATTAACTCAGATAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1360s1c1
Sequence:CCGGCGACAACTTAAAGACCGGAATCTCGAGATTCCGGTCTTTAAGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-2380s1c1
Sequence:CCGGGCACCTGTTTACAACCAGGTTCTCGAGAACCTGGTTGTAAACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025958.1-1857s1c1
Sequence:CCGGCGACCTAGAACCCACACTTATCTCGAGATAAGTGTGGGTTCTAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks