EMAIL THIS PAGE TO A FRIEND

CANT1

calcium activated nucleotidase 1

108 Gene Product Result for
Synonyms: DBQD SCAN-1 SCAN1 SHAPY
UniProtKB ID: Q8WVQ1, Q7Z2J7, Q8NG05, Q8NHP0, Q9BSD5
Gene ID:
Human(124583) Summary: This protein encoded by this gene belongs to the apyrase family. It functions as a calcium-dependent nucleotidase with a preference for UDP. Mutations in this gene are associated with Desbuquois dysplasia with hand anomalies. Alternatively spliced transcript variants have been noted for this gene.[provided by RefSeq, Mar 2010]
Mouse(76025) calcium activated nucleotidase 1
Rat(246272) calcium activated nucleotidase 1
chicken(430103) calcium activated nucleotidase 1
cow(518086) calcium activated nucleotidase 1
dog(608038) calcium activated nucleotidase 1
domestic cat(101083380) calcium activated nucleotidase 1
Horse(100057405) calcium activated nucleotidase 1
naked mole-rat(101708374) calcium activated nucleotidase 1
domestic guinea pig(100725891) calcium activated nucleotidase 1
sheep(101122609) calcium activated nucleotidase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138793 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138793 Rosetta Predictions human pricing
NM_144754 Rosetta Predictions rat pricing
NM_001025617 Rosetta Predictions mouse pricing
NM_001025618 Rosetta Predictions mouse pricing
NM_029502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165993 predicted 1590
2 SASI_Hs01_00165994 predicted 557
3 SASI_Hs01_00165995 predicted 1069
4 SASI_Hs01_00165996 predicted 1493
5 SASI_Hs01_00165997 predicted 1083
6 SASI_Hs01_00165998 predicted 1626
7 SASI_Hs01_00165999 predicted 736
8 SASI_Hs01_00166000 predicted 931
9 SASI_Hs01_00166001 predicted 1146
10 SASI_Hs01_00166002 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042242 predicted 727
2 SASI_Rn01_00042243 predicted 440
3 SASI_Rn01_00042244 predicted 1648
4 SASI_Rn01_00042245 predicted 1322
5 SASI_Rn01_00042246 predicted 393
6 SASI_Rn01_00042247 predicted 1185
7 SASI_Rn01_00042248 predicted 1261
8 SASI_Rn01_00042249 predicted 451
9 SASI_Rn01_00042250 predicted 1257
10 SASI_Rn01_00042251 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288001 predicted 259
2 SASI_Mm02_00288002 predicted 1294
3 SASI_Mm02_00288003 predicted 261
4 SASI_Mm01_00182423 predicted 876
5 SASI_Mm02_00288004 predicted 231
6 SASI_Mm02_00288005 predicted 596
7 SASI_Mm02_00288006 predicted 238
8 SASI_Mm02_00288007 predicted 1097
9 SASI_Mm01_00182426 predicted 822
10 SASI_Mm01_00182427 predicted 529
11 SASI_Mm01_00182420 predicted 360
12 SASI_Mm01_00182421 predicted 742
13 SASI_Mm01_00182422 predicted 544
14 SASI_Mm01_00182424 predicted 1070
15 SASI_Mm01_00182425 predicted 974
16 SASI_Mm01_00182428 predicted 857
17 SASI_Mm01_00182429 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186855 predicted 310
2 SASI_Mm02_00288008 predicted 1247
3 SASI_Mm01_00186856 predicted 688
4 SASI_Mm01_00186857 predicted 498
5 SASI_Mm01_00186858 predicted 837
6 SASI_Mm01_00186859 predicted 1020
7 SASI_Mm01_00186860 predicted 927
8 SASI_Mm01_00186861 predicted 783
9 SASI_Mm01_00186862 predicted 483
10 SASI_Mm01_00186863 predicted 804
11 SASI_Mm01_00186864 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073336 predicted 508
2 SASI_Mm02_00335444 predicted 1440
3 SASI_Mm01_00073337 predicted 883
4 SASI_Mm01_00073338 predicted 697
5 SASI_Mm01_00073339 predicted 1031
6 SASI_Mm01_00073340 predicted 1210
7 SASI_Mm01_00073341 predicted 1115
8 SASI_Mm01_00073342 predicted 977
9 SASI_Mm01_00073343 predicted 681
10 SASI_Mm01_00073344 predicted 997
11 SASI_Mm01_00073345 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138793
CANT1 MISSION shRNA Bacterial Glycerol Stock
calcium activated nucleotidase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1500s1c1
Sequence:CCGGCAGATCATTGTGGCCCTCAAACTCGAGTTTGAGGGCCACAATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-733s1c1
Sequence:CCGGCGGCTGGGATTCGGTATCGAACTCGAGTTCGATACCGAATCCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-563s1c1
Sequence:CCGGGAAGGTGATCCTGACGTTCTTCTCGAGAAGAACGTCAGGATCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1214s1c1
Sequence:CCGGGAACTGGGTGTCCAACTACAACTCGAGTTGTAGTTGGACACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1598s1c1
Sequence:CCGGCAAGATCGGAAGCGTGAAATACTCGAGTATTTCACGCTTCCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-804s21c1
Sequence:CCGGTCGGTATCGAATCGCAGTTATCTCGAGATAACTGCGATTCGATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1550s21c1
Sequence:CCGGACACCGACGACCAGATCATTGCTCGAGCAATGATCTGGTCGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1658s21c1
Sequence:CCGGCCAAGATCGGAAGCGTGAAATCTCGAGATTTCACGCTTCCGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-626s21c1
Sequence:CCGGAGGTGATCCTGACGTTCTTTGCTCGAGCAAAGAACGTCAGGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138793
CANT1 MISSION shRNA shRNA Plasmid DNA
calcium activated nucleotidase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1500s1c1
Sequence:CCGGCAGATCATTGTGGCCCTCAAACTCGAGTTTGAGGGCCACAATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-733s1c1
Sequence:CCGGCGGCTGGGATTCGGTATCGAACTCGAGTTCGATACCGAATCCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-563s1c1
Sequence:CCGGGAAGGTGATCCTGACGTTCTTCTCGAGAAGAACGTCAGGATCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1214s1c1
Sequence:CCGGGAACTGGGTGTCCAACTACAACTCGAGTTGTAGTTGGACACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1598s1c1
Sequence:CCGGCAAGATCGGAAGCGTGAAATACTCGAGTATTTCACGCTTCCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-804s21c1
Sequence:CCGGTCGGTATCGAATCGCAGTTATCTCGAGATAACTGCGATTCGATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1550s21c1
Sequence:CCGGACACCGACGACCAGATCATTGCTCGAGCAATGATCTGGTCGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1658s21c1
Sequence:CCGGCCAAGATCGGAAGCGTGAAATCTCGAGATTTCACGCTTCCGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-626s21c1
Sequence:CCGGAGGTGATCCTGACGTTCTTTGCTCGAGCAAAGAACGTCAGGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138793
CANT1 MISSION shRNA Lentiviral Transduction Particles
calcium activated nucleotidase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1500s1c1
Sequence:CCGGCAGATCATTGTGGCCCTCAAACTCGAGTTTGAGGGCCACAATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-733s1c1
Sequence:CCGGCGGCTGGGATTCGGTATCGAACTCGAGTTCGATACCGAATCCCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-563s1c1
Sequence:CCGGGAAGGTGATCCTGACGTTCTTCTCGAGAAGAACGTCAGGATCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1214s1c1
Sequence:CCGGGAACTGGGTGTCCAACTACAACTCGAGTTGTAGTTGGACACCCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138793.2-1598s1c1
Sequence:CCGGCAAGATCGGAAGCGTGAAATACTCGAGTATTTCACGCTTCCGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-804s21c1
Sequence:CCGGTCGGTATCGAATCGCAGTTATCTCGAGATAACTGCGATTCGATACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1550s21c1
Sequence:CCGGACACCGACGACCAGATCATTGCTCGAGCAATGATCTGGTCGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-1658s21c1
Sequence:CCGGCCAAGATCGGAAGCGTGAAATCTCGAGATTTCACGCTTCCGATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138793.3-626s21c1
Sequence:CCGGAGGTGATCCTGACGTTCTTTGCTCGAGCAAAGAACGTCAGGATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029502
VALIDATED
CANT1 MISSION shRNA Bacterial Glycerol Stock
calcium activated nucleotidase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1974s1c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1569s1c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-892s1c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1009s1c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-508s1c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-508s21c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029502.2-1974s21c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1009s21c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-892s21c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1569s21c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029502
VALIDATED
CANT1 MISSION shRNA shRNA Plasmid DNA
calcium activated nucleotidase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1974s1c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1569s1c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-892s1c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1009s1c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-508s1c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-508s21c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029502.2-1974s21c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1009s21c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-892s21c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1569s21c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029502
VALIDATED
CANT1 MISSION shRNA Lentiviral Transduction Particles
calcium activated nucleotidase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1974s1c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1569s1c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-892s1c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-1009s1c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029502.2-508s1c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-508s21c1
Sequence:CCGGCGGGTGATCCTCACGTCCTTTCTCGAGAAAGGACGTGAGGATCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029502.2-1974s21c1
Sequence:CCGGCCCGTGTTAAACCCTAGCTTACTCGAGTAAGCTAGGGTTTAACACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1009s21c1
Sequence:CCGGGAGAAGGGTTTCAAAGCTGAACTCGAGTTCAGCTTTGAAACCCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-892s21c1
Sequence:CCGGCTGATTGTCTTCAATGGGAAACTCGAGTTTCCCATTGAAGACAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029502.2-1569s21c1
Sequence:CCGGCGAAGGAATAGAGTTCATCTACTCGAGTAGATGAACTCTATTCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks