EMAIL THIS PAGE TO A FRIEND

CANX

calnexin

207 Gene Product Result for
Synonyms: CNX IP90 P90
UniProtKB ID: P27824, B2R5V8, D3DWQ3
Gene ID:
Human(821) Summary: This gene encodes a member of the calnexin family of molecular chaperones. The encoded protein is a calcium-binding, endoplasmic reticulum (ER)-associated protein that interacts transiently with newly synthesized N-linked glycoproteins, facilitating protein folding and assembly. It may also play a central role in the quality control of protein folding by retaining incorrectly folded protein subunits within the ER for degradation. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2008]
Mouse(12330) calnexin
Rat(29144) calnexin
cow(407129) calnexin
dog(403908) calnexin
chicken(416288) calnexin
sheep(101122273) calnexin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C4731 Anti-Calnexin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, rat, canine
immunofluorescence, immunoprecipitation, microarray, western blot pricing
C7617 Anti-Calnexin antibody, Mouse monoclonal clone TO-5, purified from hybridoma cell culture human
ELISA, flow cytometry, immunocytochemistry, immunohistochemistry, western blot pricing
SAB4503258 Anti-Calnexin, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2501291 Anti-CANX antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
HPA009433 Anti-CANX antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
HPA009696 Anti-CANX antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB5200081 Anti-CANX antibody produced in rabbit whole antiserum chicken, pig, monkey, dog, rabbit, rat, human, guinea pig, quail, Xenopus (weak), Drosophila, sheep, mouse, bovine, hamster
western blot pricing
SAB5200084 Anti-CANX antibody produced in rabbit whole antiserum pig, rabbit, mouse, monkey, dog, hamster, Xenopus, human, chicken, bovine, sheep, guinea pig, rat
immunocytochemistry, immunoprecipitation, western blot pricing
SAB5200097 Anti-CANX antibody produced in rabbit affinity isolated antibody pig, rabbit, mouse, chicken, hamster, sheep, bovine, human, dog, Drosophila (weak), rat, quail, Xenopus (weak), monkey, guinea pig
flow cytometry, immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4503902 Anti-phospho-Calnexin (pSer583) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300526 Monoclonal Anti-CANX antibody produced in mouse clone 3H4A7, ascites fluid human
ELISA, immunofluorescence, western blot pricing
SAB1402138 Monoclonal Anti-CANX, (C-terminal) antibody produced in mouse clone 1D4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001746 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001746 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001746 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024649 Rosetta Predictions human pricing
NM_001746 Rosetta Predictions human pricing
NM_172008 Rosetta Predictions rat pricing
NM_001110499 Rosetta Predictions mouse pricing
NM_001110500 Rosetta Predictions mouse pricing
NM_007597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024649 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181171 predicted 838
2 SASI_Hs01_00181172 predicted 928
3 SASI_Hs01_00181173 predicted 900
4 SASI_Hs01_00181174 predicted 840
5 SASI_Hs01_00181175 predicted 927
6 SASI_Hs01_00181176 predicted 1088
7 SASI_Hs01_00181177 predicted 819
8 SASI_Hs01_00181178 predicted 1089
9 SASI_Hs01_00181179 predicted 680
10 SASI_Hs01_00181180 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001746 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136932 predicted 888
2 SASI_Hs01_00136933 predicted 981
3 SASI_Hs01_00136934 predicted 954
4 SASI_Hs01_00136935 predicted 891
5 SASI_Hs01_00136936 predicted 976
6 SASI_Hs01_00136937 predicted 1141
7 SASI_Hs01_00136938 predicted 879
8 SASI_Hs01_00136939 predicted 1144
9 SASI_Hs01_00136940 predicted 731
10 SASI_Hs01_00136941 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172008 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269096 predicted 1386
2 SASI_Rn01_00110404 predicted 908
3 SASI_Rn01_00110405 predicted 1260
4 SASI_Rn02_00269097 predicted 1255
5 SASI_Rn01_00110408 predicted 804
6 SASI_Rn02_00269098 predicted 907
7 SASI_Rn01_00110410 predicted 450
8 SASI_Rn01_00110412 predicted 809
9 SASI_Rn01_00110413 predicted 553
10 SASI_Rn02_00269099 predicted 935
11 SASI_Rn01_00110406 predicted 688
12 SASI_Rn01_00110407 predicted 1022
13 SASI_Rn01_00110409 predicted 465
14 SASI_Rn01_00110411 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305558 predicted 1463
2 SASI_Mm02_00305559 predicted 891
3 SASI_Mm02_00305560 predicted 1340
4 SASI_Mm02_00305561 predicted 867
5 SASI_Mm02_00305562 predicted 1336
6 SASI_Mm02_00305563 predicted 988
7 SASI_Mm02_00305564 predicted 855
8 SASI_Mm02_00305565 predicted 889
9 SASI_Mm02_00305566 predicted 992
10 SASI_Mm02_00305567 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305568 predicted 1436
2 SASI_Mm02_00305569 predicted 856
3 SASI_Mm02_00305570 predicted 1310
4 SASI_Mm02_00305571 predicted 836
5 SASI_Mm02_00305572 predicted 1302
6 SASI_Mm02_00305573 predicted 960
7 SASI_Mm02_00305574 predicted 825
8 SASI_Mm02_00305575 predicted 859
9 SASI_Mm02_00305576 predicted 962
10 SASI_Mm02_00305577 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096242 predicted 1471
2 SASI_Mm01_00096243 predicted 895
3 SASI_Mm01_00096244 predicted 1339
4 SASI_Mm01_00096245 predicted 865
5 SASI_Mm01_00096246 predicted 1346
6 SASI_Mm01_00096247 predicted 990
7 SASI_Mm01_00096248 predicted 859
8 SASI_Mm01_00096249 predicted 891
9 SASI_Mm01_00096250 predicted 991
10 SASI_Mm01_00096251 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007597
VALIDATED
CANX MISSION shRNA Bacterial Glycerol Stock
calnexin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-791s21c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-999s21c1
Sequence:CCGGGTAAACCCTTCACGTGAAATTCTCGAGAATTTCACGTGAAGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1164s21c1
Sequence:CCGGGACGACGAACCTGAGTATATTCTCGAGAATATACTCAGGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1298s21c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-267s21c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-1216s1c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-185s1c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007597.2-634s1c1
Sequence:CCGGCCTGGATCAATTCCACGACAACTCGAGTTGTCGTGGAATTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007597.2-2011s1c1
Sequence:CCGGCCAGTGAATACTAGCCTGTAACTCGAGTTACAGGCTAGTATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-709s1c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007597
VALIDATED
CANX MISSION shRNA shRNA Plasmid DNA
calnexin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-791s21c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-999s21c1
Sequence:CCGGGTAAACCCTTCACGTGAAATTCTCGAGAATTTCACGTGAAGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1164s21c1
Sequence:CCGGGACGACGAACCTGAGTATATTCTCGAGAATATACTCAGGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1298s21c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-267s21c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-1216s1c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-185s1c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007597.2-634s1c1
Sequence:CCGGCCTGGATCAATTCCACGACAACTCGAGTTGTCGTGGAATTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007597.2-2011s1c1
Sequence:CCGGCCAGTGAATACTAGCCTGTAACTCGAGTTACAGGCTAGTATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-709s1c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007597
VALIDATED
CANX MISSION shRNA Lentiviral Transduction Particles
calnexin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-791s21c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-999s21c1
Sequence:CCGGGTAAACCCTTCACGTGAAATTCTCGAGAATTTCACGTGAAGGGTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1164s21c1
Sequence:CCGGGACGACGAACCTGAGTATATTCTCGAGAATATACTCAGGTTCGTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-1298s21c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007597.3-267s21c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-1216s1c1
Sequence:CCGGGCAGCGACCTATGATTGACAACTCGAGTTGTCAATCATAGGTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-185s1c1
Sequence:CCGGGACGCGATTGATATTGAAGATCTCGAGATCTTCAATATCAATCGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007597.2-634s1c1
Sequence:CCGGCCTGGATCAATTCCACGACAACTCGAGTTGTCGTGGAATTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008463    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007597.2-2011s1c1
Sequence:CCGGCCAGTGAATACTAGCCTGTAACTCGAGTTACAGGCTAGTATTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007597.2-709s1c1
Sequence:CCGGGCATTTCATCTTTCGACACAACTCGAGTTGTGTCGAAAGATGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001746
VALIDATED
CANX MISSION shRNA Bacterial Glycerol Stock
calnexin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-997s21c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-439s21c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-1501s21c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-702s21c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-456s21c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-390s1c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-931s1c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-1435s1c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-636s1c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-373s1c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001746
VALIDATED
CANX MISSION shRNA shRNA Plasmid DNA
calnexin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-997s21c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-439s21c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-1501s21c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-702s21c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-456s21c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-390s1c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-931s1c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-1435s1c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-636s1c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-373s1c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001746
VALIDATED
CANX MISSION shRNA Lentiviral Transduction Particles
calnexin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-997s21c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-439s21c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-1501s21c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-702s21c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001746.3-456s21c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-390s1c1
Sequence:CCGGCGATGATGAAATTGCCAAATACTCGAGTATTTGGCAATTTCATCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-931s1c1
Sequence:CCGGCGTGAAATTGAGGACCCAGAACTCGAGTTCTGGGTCCTCAATTTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-1435s1c1
Sequence:CCGGGCTGATCGAAGAATAGTTGATCTCGAGATCAACTATTCTTCGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029358    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-636s1c1
Sequence:CCGGCCTGGATCAGTTCCATGACAACTCGAGTTGTCATGGAACTGATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001746.2-373s1c1
Sequence:CCGGGCCAAGAAAGACGATACCGATCTCGAGATCGGTATCGTCTTTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks