EMAIL THIS PAGE TO A FRIEND

CAP1

CAP, adenylate cyclase-associated protein 1 (yeast)

141 Gene Product Result for
Synonyms: CAP CAP1-PEN
UniProtKB ID: Q01518, Q53HR7, Q5T0S1, Q5T0S2, Q6I9U6
Gene ID:
Human(10487) Summary: The protein encoded by this gene is related to the S. cerevisiae CAP protein, which is involved in the cyclic AMP pathway. The human protein is able to interact with other molecules of the same protein, as well as with CAP2 and actin. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2008]
Mouse(12331) CAP, adenylate cyclase-associated protein 1 (yeast)
Rat(64185) CAP, adenylate cyclase-associated protein 1 (yeast)
Zebrafish(334527) Cap1 CAP, adenylate cyclase-associated protein 1
cow(504519) CAP, adenylate cyclase-associated protein 1 (yeast)
Horse(100068319) CAP, adenylate cyclase-associated protein 1 (yeast)
domestic cat(101097161) CAP, adenylate cyclase-associated protein 1 (yeast)
dog(475317) CAP, adenylate cyclase-associated protein 1 (yeast)
chicken(419680) CAP, adenylate cyclase-associated protein 1 (yeast)
Thale Cress(829600) cyclase associated protein 1
domestic guinea pig(100720017) CAP, adenylate cyclase-associated protein 1 (yeast)
sheep(101120787) CAP, adenylate cyclase-associated protein 1 (yeast)
Domestic Rabbit(100340076) CAP, adenylate cyclase-associated protein 1 (yeast)
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006367 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007598 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007598 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007598 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105530 Rosetta Predictions human pricing
NM_006367 Rosetta Predictions human pricing
NM_022383 Rosetta Predictions rat pricing
NM_007598 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324221 predicted 1620
2 SASI_Hs02_00324222 predicted 1333
3 SASI_Hs02_00324223 predicted 1624
4 SASI_Hs02_00324224 predicted 1184
5 SASI_Hs02_00324225 predicted 1680
6 SASI_Hs02_00324226 predicted 544
7 SASI_Hs02_00324227 predicted 1499
8 SASI_Hs02_00324228 predicted 517
9 SASI_Hs02_00324229 predicted 1490
10 SASI_Hs02_00324230 predicted 1279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011912 predicted 1638
2 SASI_Hs01_00011915 predicted 1343
3 SASI_Hs02_00341428 predicted 1644
4 SASI_Hs01_00011908 predicted 1201
5 SASI_Hs01_00011909 predicted 1689
6 SASI_Hs02_00341429 predicted 570
7 SASI_Hs01_00011911 predicted 1521
8 SASI_Hs01_00011913 predicted 529
9 SASI_Hs01_00011914 predicted 1507
10 SASI_Hs01_00011916 predicted 1292
11 SASI_Hs01_00011910 predicted 333
12 SASI_Hs01_00011917 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081705 predicted 881
2 SASI_Rn01_00081706 predicted 662
3 SASI_Rn01_00081708 predicted 407
4 SASI_Rn01_00081709 predicted 450
5 SASI_Rn01_00081710 predicted 1575
6 SASI_Rn01_00081711 predicted 1295
7 SASI_Rn02_00263146 predicted 951
8 SASI_Rn01_00081713 predicted 693
9 SASI_Rn01_00081714 predicted 660
10 SASI_Rn02_00263147 predicted 502
11 SASI_Rn01_00081707 predicted 1188
12 SASI_Rn01_00081712 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119562 predicted 1346
2 SASI_Mm02_00312031 predicted 824
3 SASI_Mm01_00119564 predicted 521
4 SASI_Mm01_00119565 predicted 1519
5 SASI_Mm02_00312032 predicted 1240
6 SASI_Mm01_00119567 predicted 392
7 SASI_Mm01_00119568 predicted 357
8 SASI_Mm01_00119569 predicted 1122
9 SASI_Mm01_00119570 predicted 884
10 SASI_Mm02_00312033 predicted 635
11 SASI_Mm01_00119561 predicted 1320
12 SASI_Mm01_00119563 predicted 321
13 SASI_Mm01_00119566 predicted 330
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006367
VALIDATED
CAP1 MISSION shRNA Bacterial Glycerol Stock
CAP, adenylate cyclase-associated protein 1 (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-183s1c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-510s1c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-641s1c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-381s1c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-1427s1c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-677s21c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006367.3-350s21c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-548s21c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-1594s21c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-808s21c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006367
VALIDATED
CAP1 MISSION shRNA shRNA Plasmid DNA
CAP, adenylate cyclase-associated protein 1 (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-183s1c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-510s1c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-641s1c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-381s1c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-1427s1c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-677s21c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006367.3-350s21c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-548s21c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-1594s21c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-808s21c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006367
VALIDATED
CAP1 MISSION shRNA Lentiviral Transduction Particles
CAP, adenylate cyclase-associated protein 1 (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-183s1c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-510s1c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-641s1c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-381s1c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006367.2-1427s1c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-677s21c1
Sequence:CCGGCCTGGCCCTTATGTGAAAGAACTCGAGTTCTTTCACATAAGGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006367.3-350s21c1
Sequence:CCGGGCTCCATATGTGCAGGCATTTCTCGAGAAATGCCTGCACATATGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-548s21c1
Sequence:CCGGCCCATCTCAGAGCAGATCAAACTCGAGTTTGATCTGCTCTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-1594s21c1
Sequence:CCGGGCAGTTCAAGACCCTATGGAACTCGAGTTCCATAGGGTCTTGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006367.3-808s21c1
Sequence:CCGGGCAGGCTTACATTAAGGAGTTCTCGAGAACTCCTTAATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007598
VALIDATED
CAP1 MISSION shRNA Bacterial Glycerol Stock
CAP, adenylate cyclase-associated protein 1 (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1540s1c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007598.2-1249s1c1
Sequence:CCGGGCCAACCATTTCCATTAACAACTCGAGTTGTTAATGGAAATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-613s1c1
Sequence:CCGGGCAGGCTTACATCAAGGAGTTCTCGAGAACTCCTTGATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1140s1c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-614s1c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-608s21c1
Sequence:CCGGCAGAGCTTACTTGAGTATATGCTCGAGCATATACTCAAGTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1165s21c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-639s21c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-1565s21c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1382s21c1
Sequence:CCGGTCCTACCGAAGGCGGTGATTTCTCGAGAAATCACCGCCTTCGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007598
VALIDATED
CAP1 MISSION shRNA shRNA Plasmid DNA
CAP, adenylate cyclase-associated protein 1 (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1540s1c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007598.2-1249s1c1
Sequence:CCGGGCCAACCATTTCCATTAACAACTCGAGTTGTTAATGGAAATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-613s1c1
Sequence:CCGGGCAGGCTTACATCAAGGAGTTCTCGAGAACTCCTTGATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1140s1c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-614s1c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-608s21c1
Sequence:CCGGCAGAGCTTACTTGAGTATATGCTCGAGCATATACTCAAGTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1165s21c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-639s21c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-1565s21c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1382s21c1
Sequence:CCGGTCCTACCGAAGGCGGTGATTTCTCGAGAAATCACCGCCTTCGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007598
VALIDATED
CAP1 MISSION shRNA Lentiviral Transduction Particles
CAP, adenylate cyclase-associated protein 1 (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1540s1c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007598.2-1249s1c1
Sequence:CCGGGCCAACCATTTCCATTAACAACTCGAGTTGTTAATGGAAATGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-613s1c1
Sequence:CCGGGCAGGCTTACATCAAGGAGTTCTCGAGAACTCCTTGATGTAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-1140s1c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007598.2-614s1c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-608s21c1
Sequence:CCGGCAGAGCTTACTTGAGTATATGCTCGAGCATATACTCAAGTAAGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1165s21c1
Sequence:CCGGCCATTACAGTAGATAACTGTACTCGAGTACAGTTATCTACTGTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-639s21c1
Sequence:CCGGCAGGCTTACATCAAGGAGTTTCTCGAGAAACTCCTTGATGTAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007598.3-1565s21c1
Sequence:CCGGCCTCTACCTTTCTGCTCTTAACTCGAGTTAAGAGCAGAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007598.3-1382s21c1
Sequence:CCGGTCCTACCGAAGGCGGTGATTTCTCGAGAAATCACCGCCTTCGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks