EMAIL THIS PAGE TO A FRIEND

CAPG

capping protein (actin filament), gelsolin-like

69 Gene Product Result for
Synonyms: AFCP MCP
UniProtKB ID: P40121, B8ZZS7, D6W5K8, Q53SA7
Gene ID:
Human(822) Summary: This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]
Mouse(12332) capping protein (actin filament), gelsolin-like
Rat(297339) capping protein (actin filament), gelsolin-like
Zebrafish(336597) capping protein (actin filament), gelsolin-like
chicken(431244) capping protein (actin filament), gelsolin-like
cow(353121) capping protein (actin filament), gelsolin-like
Horse(100053297) capping protein (actin filament), gelsolin-like
domestic cat(101084952) capping protein (actin filament), gelsolin-like
dog(483082) capping protein (actin filament), gelsolin-like
naked mole-rat(101704172) capping protein (actin filament), gelsolin-like
domestic guinea pig(100729538) capping protein (actin filament), gelsolin-like
sheep(101101968) capping protein (actin filament), gelsolin-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001747 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001747 Rosetta Predictions human pricing
NM_001013086 Rosetta Predictions rat pricing
NM_001042534 Rosetta Predictions mouse pricing
NM_007599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176200 predicted 1073
2 SASI_Hs01_00176201 predicted 1062
3 SASI_Hs01_00176202 predicted 648
4 SASI_Hs01_00176203 predicted 544
5 SASI_Hs01_00176204 predicted 597
6 SASI_Hs01_00176205 predicted 1076
7 SASI_Hs01_00176206 predicted 432
8 SASI_Hs01_00176207 predicted 1192
9 SASI_Hs01_00176208 predicted 545
10 SASI_Hs01_00176209 predicted 990
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200725 predicted 322
2 SASI_Rn01_00039002 predicted 404
3 SASI_Rn01_00039004 predicted 1109
4 SASI_Rn01_00039005 predicted 1125
5 SASI_Rn01_00039006 predicted 662
6 SASI_Rn01_00039007 predicted 1051
7 SASI_Rn01_00039008 predicted 447
8 SASI_Rn01_00039009 predicted 483
9 SASI_Rn02_00200726 predicted 1243
10 SASI_Rn01_00039010 predicted 997
11 SASI_Rn01_00039003 predicted 773
12 SASI_Rn01_00039011 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290555 predicted 879
2 SASI_Mm02_00290556 predicted 604
3 SASI_Mm02_00290557 predicted 885
4 SASI_Mm02_00290558 predicted 814
5 SASI_Mm02_00290559 predicted 899
6 SASI_Mm02_00290560 predicted 924
7 SASI_Mm02_00290561 predicted 721
8 SASI_Mm02_00290562 predicted 371
9 SASI_Mm02_00290563 predicted 354
10 SASI_Mm02_00290564 predicted 417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312034 predicted 861
2 SASI_Mm01_00157211 predicted 581
3 SASI_Mm02_00312035 predicted 861
4 SASI_Mm02_00312036 predicted 785
5 SASI_Mm02_00312037 predicted 870
6 SASI_Mm02_00312038 predicted 894
7 SASI_Mm02_00312039 predicted 696
8 SASI_Mm01_00157212 predicted 343
9 SASI_Mm02_00312040 predicted 325
10 SASI_Mm02_00312041 predicted 394
11 SASI_Mm01_00157213 predicted 468
12 SASI_Mm01_00157214 predicted 261
13 SASI_Mm01_00157215 predicted 342
14 SASI_Mm01_00157216 predicted 601
15 SASI_Mm01_00157217 predicted 375
16 SASI_Mm01_00157218 predicted 516
17 SASI_Mm01_00157219 predicted 243
18 SASI_Mm01_00157220 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007599
VALIDATED
CAPG MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament), gelsolin-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-370s1c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1242s1c1
Sequence:CCGGGAGTCCCATCTTCAAGCAATTCTCGAGAATTGCTTGAAGATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-883s1c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1008s1c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1245s1c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-818s21c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-693s21c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-180s21c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-1055s21c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007599
VALIDATED
CAPG MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament), gelsolin-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-370s1c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1242s1c1
Sequence:CCGGGAGTCCCATCTTCAAGCAATTCTCGAGAATTGCTTGAAGATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-883s1c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1008s1c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1245s1c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-818s21c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-693s21c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-180s21c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-1055s21c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007599
VALIDATED
CAPG MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament), gelsolin-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-370s1c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1242s1c1
Sequence:CCGGGAGTCCCATCTTCAAGCAATTCTCGAGAATTGCTTGAAGATGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-883s1c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1008s1c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007599.1-1245s1c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-818s21c1
Sequence:CCGGTGGACAGATGAATCTGACCAACTCGAGTTGGTCAGATTCATCTGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-693s21c1
Sequence:CCGGCCAGCCGAGATGATTCAGGTTCTCGAGAACCTGAATCATCTCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-180s21c1
Sequence:CCGGTCCTACCTAGTGCTTCACAATCTCGAGATTGTGAAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007599.3-1055s21c1
Sequence:CCGGTCCCATCTTCAAGCAATTCTTCTCGAGAAGAATTGCTTGAAGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001747
VALIDATED
CAPG MISSION shRNA Bacterial Glycerol Stock
capping protein (actin filament), gelsolin-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-1019s1c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-419s1c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-188s1c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-668s1c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-877s1c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-389s21c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-869s21c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1078s21c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1220s21c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-620s21c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001747
VALIDATED
CAPG MISSION shRNA shRNA Plasmid DNA
capping protein (actin filament), gelsolin-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-1019s1c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-419s1c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-188s1c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-668s1c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-877s1c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-389s21c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-869s21c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1078s21c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1220s21c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-620s21c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001747
VALIDATED
CAPG MISSION shRNA Lentiviral Transduction Particles
capping protein (actin filament), gelsolin-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-1019s1c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-419s1c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-188s1c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001747.1-668s1c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001747.1-877s1c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-389s21c1
Sequence:CCGGTCCTACCTAGTGCTGCACAATCTCGAGATTGTGCAGCACTAGGTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-869s21c1
Sequence:CCGGCAGGTGGAGATTGTCACTGATCTCGAGATCAGTGACAATCTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1078s21c1
Sequence:CCGGGCTGATATCTGATGACTGCTTCTCGAGAAGCAGTCATCAGATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-1220s21c1
Sequence:CCGGCCGAACACTCAGGTGGAGATTCTCGAGAATCTCCACCTGAGTGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001747.2-620s21c1
Sequence:CCGGGCATTTCACAAGACCTCCACACTCGAGTGTGGAGGTCTTGTGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks