EMAIL THIS PAGE TO A FRIEND

CAPN10

calpain 10

Synonyms: CANP10 NIDDM1
Gene ID:
Human(11132) Summary: Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
Mouse(23830) calpain 10
Rat(63834) calpain 10
sheep(101104198) calpain 10
Zebrafish(570311) calpain 10
chicken(424945) calpain 10
dog(607311) calpain 10
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021251 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021251 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021251 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021251 Rosetta Predictions human pricing
NM_023083 Rosetta Predictions human pricing
NM_023085 Rosetta Predictions human pricing
NM_023089 Rosetta Predictions human pricing
NM_031673 Rosetta Predictions rat pricing
NM_011796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021251 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175156 predicted 629
2 SASI_Hs01_00175157 predicted 751
3 SASI_Hs01_00175158 predicted 570
4 SASI_Hs01_00175159 predicted 529
5 SASI_Hs01_00175160 predicted 752
6 SASI_Hs01_00175161 predicted 544
7 SASI_Hs01_00175162 predicted 567
8 SASI_Hs01_00175163 predicted 555
9 SASI_Hs01_00175165 predicted 665
10 SASI_Hs02_00354909 predicted 572
11 SASI_Hs01_00175164 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149015 predicted 2236
2 SASI_Hs01_00149016 predicted 2351
3 SASI_Hs01_00149017 predicted 2168
4 SASI_Hs01_00149018 predicted 2130
5 SASI_Hs01_00149019 predicted 2355
6 SASI_Hs01_00149020 predicted 2145
7 SASI_Hs01_00149021 predicted 2176
8 SASI_Hs01_00149022 predicted 2156
9 SASI_Hs01_00149024 predicted 2269
10 SASI_Hs02_00356330 predicted 2173
11 SASI_Hs01_00149023 predicted 2240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088088 predicted 1773
2 SASI_Hs01_00088089 predicted 1891
3 SASI_Hs01_00088090 predicted 1709
4 SASI_Hs01_00088091 predicted 1667
5 SASI_Hs01_00088092 predicted 1890
6 SASI_Hs01_00088093 predicted 1684
7 SASI_Hs01_00088094 predicted 1711
8 SASI_Hs01_00088095 predicted 1690
9 SASI_Hs01_00088097 predicted 1799
10 SASI_Hs02_00356331 predicted 1703
11 SASI_Hs01_00088096 predicted 1775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356332 predicted 495
2 SASI_Hs01_00193399 predicted 538
3 SASI_Hs01_00193400 predicted 237
4 SASI_Hs01_00193402 predicted 353
5 SASI_Hs02_00356333 predicted 334
6 SASI_Hs01_00193403 predicted 456
7 SASI_Hs01_00193404 predicted 529
8 SASI_Hs01_00193405 predicted 238
9 SASI_Hs01_00193406 predicted 407
10 SASI_Hs01_00193407 predicted 519
11 SASI_Hs01_00193398 predicted 490
12 SASI_Hs01_00193401 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099717 predicted 1446
2 SASI_Rn01_00099718 predicted 1997
3 SASI_Rn01_00099719 predicted 1325
4 SASI_Rn01_00099720 predicted 2107
5 SASI_Rn01_00099721 predicted 1968
6 SASI_Rn01_00099722 predicted 1823
7 SASI_Rn01_00099723 predicted 222
8 SASI_Rn01_00099724 predicted 1017
9 SASI_Rn01_00099725 predicted 1769
10 SASI_Rn01_00099726 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054766 predicted 1787
2 SASI_Mm01_00054767 predicted 1897
3 SASI_Mm02_00321461 predicted 1010
4 SASI_Mm02_00321462 predicted 2342
5 SASI_Mm01_00054768 predicted 1019
6 SASI_Mm01_00054771 predicted 2161
7 SASI_Mm01_00054772 predicted 571
8 SASI_Mm01_00054773 predicted 711
9 SASI_Mm01_00054774 predicted 1220
10 SASI_Mm01_00054775 predicted 2438
11 SASI_Mm01_00054769 predicted 632
12 SASI_Mm01_00054770 predicted 790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011796
VALIDATED
CAPN10 MISSION shRNA Bacterial Glycerol Stock
calpain 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1272s1c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011796.1-392s1c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1726s1c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1921s1c1
Sequence:CCGGCGGTAACCATAGCAACCAGAACTCGAGTTCTGGTTGCTATGGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-542s1c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-984s21c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-834s21c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-1714s21c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-2168s21c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011796
VALIDATED
CAPN10 MISSION shRNA shRNA Plasmid DNA
calpain 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1272s1c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011796.1-392s1c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1726s1c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1921s1c1
Sequence:CCGGCGGTAACCATAGCAACCAGAACTCGAGTTCTGGTTGCTATGGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-542s1c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-984s21c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-834s21c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-1714s21c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-2168s21c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011796
VALIDATED
CAPN10 MISSION shRNA Lentiviral Transduction Particles
calpain 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1272s1c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011796.1-392s1c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1726s1c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-1921s1c1
Sequence:CCGGCGGTAACCATAGCAACCAGAACTCGAGTTCTGGTTGCTATGGTTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011796.1-542s1c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-984s21c1
Sequence:CCGGCCTTAGTGGATCTCACTGGAACTCGAGTTCCAGTGAGATCCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-834s21c1
Sequence:CCGGCCATAGATGATCGTCTGCCTTCTCGAGAAGGCAGACGATCATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-1714s21c1
Sequence:CCGGGCACATCTGGAAGGTAGAGAACTCGAGTTCTCTACCTTCCAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011796.2-2168s21c1
Sequence:CCGGCCCATTGGTTTCCATGTCTTTCTCGAGAAAGACATGGAAACCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021251
VALIDATED
CAPN10 MISSION shRNA Bacterial Glycerol Stock
calpain 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_021251.2-508s1c1
Sequence:CCGGAGGATTGACAGGCCATCCATTCTCGAGAATGGATGGCCTGTCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-503s21c1
Sequence:CCGGACCATCGCAACCAGGATTGACCTCGAGGTCAATCCTGGTTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-575s21c1
Sequence:CCGGTCCGTCATGGCAGTGATGAAACTCGAGTTTCATCACTGCCATGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-529s21c1
Sequence:CCGGATCCATTCACAGCCAGGAGATCTCGAGATCTCCTGGCTGTGAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-258s21c1
Sequence:CCGGCGCTCTTCTGCGACTTGTCTACTCGAGTAGACAAGTCGCAGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021251
VALIDATED
CAPN10 MISSION shRNA shRNA Plasmid DNA
calpain 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_021251.2-508s1c1
Sequence:CCGGAGGATTGACAGGCCATCCATTCTCGAGAATGGATGGCCTGTCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-503s21c1
Sequence:CCGGACCATCGCAACCAGGATTGACCTCGAGGTCAATCCTGGTTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-575s21c1
Sequence:CCGGTCCGTCATGGCAGTGATGAAACTCGAGTTTCATCACTGCCATGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-529s21c1
Sequence:CCGGATCCATTCACAGCCAGGAGATCTCGAGATCTCCTGGCTGTGAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-258s21c1
Sequence:CCGGCGCTCTTCTGCGACTTGTCTACTCGAGTAGACAAGTCGCAGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021251
VALIDATED
CAPN10 MISSION shRNA Lentiviral Transduction Particles
calpain 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_021251.2-508s1c1
Sequence:CCGGAGGATTGACAGGCCATCCATTCTCGAGAATGGATGGCCTGTCAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-503s21c1
Sequence:CCGGACCATCGCAACCAGGATTGACCTCGAGGTCAATCCTGGTTGCGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-575s21c1
Sequence:CCGGTCCGTCATGGCAGTGATGAAACTCGAGTTTCATCACTGCCATGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-529s21c1
Sequence:CCGGATCCATTCACAGCCAGGAGATCTCGAGATCTCCTGGCTGTGAATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021251.3-258s21c1
Sequence:CCGGCGCTCTTCTGCGACTTGTCTACTCGAGTAGACAAGTCGCAGAAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks