EMAIL THIS PAGE TO A FRIEND

CAPN11

calpain 11

Synonyms: calpain11
UniProtKB ID: Q9UMQ6, B2RA64, Q5T3G1, Q8N4R5
Gene ID:
Human(11131) Summary: Calpains constitute a family of intracellular calcium-dependent cysteine proteases. There are eight members in this superfamily. They consist of a variable 80 kDa subunit and an invariant 30 kDa subunit. This calpain protein appears to have protease activity and calcium-binding ability. A similar mouse protein may play a functional role in spermatogenesis and in the regulation of calcium-dependent signal transduction events during meiosis. [provided by RefSeq, Dec 2008]
Mouse(268958) calpain 11
Rat(408218) calpain 11
dog(609624) calpain 11
Horse(100067717) calpain 11
cow(527966) calpain 11
sheep(101113966) calpain 11
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007058 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007058 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007058 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_193876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040091 MISSION® esiRNA esiRNA human CAPN11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007058 Rosetta Predictions human pricing
NM_001002806 Rosetta Predictions rat pricing
NM_001013767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169163 predicted 1605
2 SASI_Hs01_00169164 predicted 565
3 SASI_Hs01_00169165 predicted 1748
4 SASI_Hs01_00169166 predicted 1626
5 SASI_Hs01_00169167 predicted 405
6 SASI_Hs01_00169168 predicted 922
7 SASI_Hs01_00169169 predicted 2193
8 SASI_Hs01_00169170 predicted 797
9 SASI_Hs01_00169171 predicted 1690
10 SASI_Hs01_00169172 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070758 predicted 1768
2 SASI_Rn01_00070759 predicted 857
3 SASI_Rn01_00070760 predicted 1576
4 SASI_Rn02_00197991 predicted 2102
5 SASI_Rn02_00197992 predicted 749
6 SASI_Rn01_00070763 predicted 872
7 SASI_Rn01_00070764 predicted 278
8 SASI_Rn01_00070765 predicted 1297
9 SASI_Rn01_00070766 predicted 1813
10 SASI_Rn02_00197993 predicted 1934
11 SASI_Rn01_00070757 predicted 348
12 SASI_Rn01_00070761 predicted 2057
13 SASI_Rn01_00070762 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104692 predicted 1693
2 SASI_Mm01_00104693 predicted 1114
3 SASI_Mm01_00104695 predicted 1429
4 SASI_Mm02_00287304 predicted 1041
5 SASI_Mm01_00104696 predicted 1766
6 SASI_Mm01_00104698 predicted 245
7 SASI_Mm01_00104699 predicted 1817
8 SASI_Mm01_00104700 predicted 1667
9 SASI_Mm01_00104701 predicted 490
10 SASI_Mm02_00287305 predicted 1766
11 SASI_Mm01_00104694 predicted 1690
12 SASI_Mm01_00104697 predicted 1570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007058
CAPN11 MISSION shRNA Bacterial Glycerol Stock
calpain 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-1747s21c1
Sequence:CCGGAGGACTTCCTACATTTGTTTACTCGAGTAAACAAATGTAGGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-147s21c1
Sequence:CCGGGGAATGGTGGCTCACATAAACCTCGAGGTTTATGTGAGCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2193s1c1
Sequence:CCGGCCCAAGAATACTGGCCATATTCTCGAGAATATGGCCAGTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-611s1c1
Sequence:CCGGGCTGCCCACAAAGAATGACAACTCGAGTTGTCATTCTTTGTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2060s1c1
Sequence:CCGGCAAGCTGAACAACAAGGTAATCTCGAGATTACCTTGTTGTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-371s1c1
Sequence:CCGGGCCCAAGGATATCATAAACAACTCGAGTTGTTTATGATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-1121s1c1
Sequence:CCGGCTACCAAGATTTCCTGAACAACTCGAGTTGTTCAGGAAATCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007058
CAPN11 MISSION shRNA shRNA Plasmid DNA
calpain 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-1747s21c1
Sequence:CCGGAGGACTTCCTACATTTGTTTACTCGAGTAAACAAATGTAGGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-147s21c1
Sequence:CCGGGGAATGGTGGCTCACATAAACCTCGAGGTTTATGTGAGCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2193s1c1
Sequence:CCGGCCCAAGAATACTGGCCATATTCTCGAGAATATGGCCAGTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-611s1c1
Sequence:CCGGGCTGCCCACAAAGAATGACAACTCGAGTTGTCATTCTTTGTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2060s1c1
Sequence:CCGGCAAGCTGAACAACAAGGTAATCTCGAGATTACCTTGTTGTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-371s1c1
Sequence:CCGGGCCCAAGGATATCATAAACAACTCGAGTTGTTTATGATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-1121s1c1
Sequence:CCGGCTACCAAGATTTCCTGAACAACTCGAGTTGTTCAGGAAATCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007058
CAPN11 MISSION shRNA Lentiviral Transduction Particles
calpain 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-1747s21c1
Sequence:CCGGAGGACTTCCTACATTTGTTTACTCGAGTAAACAAATGTAGGAAGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007058.3-147s21c1
Sequence:CCGGGGAATGGTGGCTCACATAAACCTCGAGGTTTATGTGAGCCACCATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2193s1c1
Sequence:CCGGCCCAAGAATACTGGCCATATTCTCGAGAATATGGCCAGTATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-611s1c1
Sequence:CCGGGCTGCCCACAAAGAATGACAACTCGAGTTGTCATTCTTTGTGGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-2060s1c1
Sequence:CCGGCAAGCTGAACAACAAGGTAATCTCGAGATTACCTTGTTGTTCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-371s1c1
Sequence:CCGGGCCCAAGGATATCATAAACAACTCGAGTTGTTTATGATATCCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007058.2-1121s1c1
Sequence:CCGGCTACCAAGATTTCCTGAACAACTCGAGTTGTTCAGGAAATCTTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193876
CAPN11 MISSION shRNA Bacterial Glycerol Stock
calpain 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1422s1c1
Sequence:CCGGGCTGTTTAAGATAATGGCAAACTCGAGTTTGCCATTATCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1879s1c1
Sequence:CCGGGATATTAACCAGTGGCTGCAACTCGAGTTGCAGCCACTGGTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-994s1c1
Sequence:CCGGCCAGAGGATGACTCTGAGAAACTCGAGTTTCTCAGAGTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-281s1c1
Sequence:CCGGCTAGGAACAACAAGCTGGTATCTCGAGATACCAGCTTGTTGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1459s1c1
Sequence:CCGGGATATGTATGCACTACACAAACTCGAGTTTGTGTAGTGCATACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193876
CAPN11 MISSION shRNA shRNA Plasmid DNA
calpain 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1422s1c1
Sequence:CCGGGCTGTTTAAGATAATGGCAAACTCGAGTTTGCCATTATCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1879s1c1
Sequence:CCGGGATATTAACCAGTGGCTGCAACTCGAGTTGCAGCCACTGGTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-994s1c1
Sequence:CCGGCCAGAGGATGACTCTGAGAAACTCGAGTTTCTCAGAGTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-281s1c1
Sequence:CCGGCTAGGAACAACAAGCTGGTATCTCGAGATACCAGCTTGTTGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1459s1c1
Sequence:CCGGGATATGTATGCACTACACAAACTCGAGTTTGTGTAGTGCATACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193876
CAPN11 MISSION shRNA Lentiviral Transduction Particles
calpain 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1422s1c1
Sequence:CCGGGCTGTTTAAGATAATGGCAAACTCGAGTTTGCCATTATCTTAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1879s1c1
Sequence:CCGGGATATTAACCAGTGGCTGCAACTCGAGTTGCAGCCACTGGTTAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-994s1c1
Sequence:CCGGCCAGAGGATGACTCTGAGAAACTCGAGTTTCTCAGAGTCATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-281s1c1
Sequence:CCGGCTAGGAACAACAAGCTGGTATCTCGAGATACCAGCTTGTTGTTCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193876.3-1459s1c1
Sequence:CCGGGATATGTATGCACTACACAAACTCGAGTTTGTGTAGTGCATACATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks